Study On Relationship Between PKC And Biological Features Of Ankyrin And CD44 Molecules In Vascular Endothelial Cells

IntroductionCD44 molelules as an important adhesion molecules exist in a variety of cells including vascular endothelial cells, bloodcells, fibroblasts, which combine with certain extracellular matrixmolecules such as HA, Collagen, fibronec-tin and so on. They mediate physiological and pathological processes such as recycle of lympocytes, metastasis of tumor, transduction of signal. The cytoplas-mic side of CD44 molecule is connected with ankyrin, one of cytoskeleton and has a highly distinctive binding domain which contains PKC phosphorylation sites. It was found that PKC phosphorlyation in the sites could enhance the binding affinity between CD44 and ankyrin, It was also found that PKC activation could up - regulate the expression of ICAM - 1, VCAM - 1 in endothelial cells and CD44 Variant isoforms in tumor cells. Therefore, we planned to survey the PKC effect on expression and adhesion of CD44 in vascular eudothelial cells. Ankyin is the bridge between CD44 transmembrane glycoprotein and cytoplasmic cytoskeleton. It was found that PKC activation also caused ankyrin redistribution in lymphocyte membrane. Does it occur in vascular endothelial cells and result in the change of spacial structure of cytoskeleton network? If ankyrin redistribution occur, whether CD44 could redistribute accompaning with ankyrin because of the binding of CD44 and ankyrin? We surveyed tne subcellular distribution of CD44 and ankyrin by indirect immunofluorescene. PKC is a signal transduction enzyme. The elelvated Ca2+ level will activate PKC after CD44 molecules combining with gametophytes, because PKC is the target protein of the second mes-sager Ca + and DAG. It is the phospborylation that passes the extracellular stimulating signals. But what is the above signal pathway? Raf -1 kinase activation is the first step of many biochemical cytoplasmic signal transduction in many cells. It may receive the activation of tyrosine kinase family or PKC, and cause downstream signal cascade, such as Raf - 1/MEK/ERK. We surveyed the phosphorylation of membrane CD44 and expression of CD44 gene, and comparatively analysed the Raf -1 kinase, MEK, ERK activity after PKC activation to understand the signal regulating mechanism of CD44 in vascular endothelial cells.Methods1. HUVECs' culture and treatmentHUVECs were grown in RPMI - 1640 medium supplemented with 10% FBS at 37°C in 5% CO2 and 95% air. HUVECs were subcultured in serum -free medium for 24 ~48 hours before treatment.2. Protein quantity determinationCoomassie method was used to detect the concentration of protein solution.3. PKC activity assayPKC activity was measured in cultured confluent cells after cells separated into cytosolic and particulate fraction as previously described. The assay was carried out in [r -32P] ATP and exogenous substrates protamine at 30 °C. One unit of PKC activity was defined as the amount catalyzing the transfer of 1 pmol of 32P from [ r - 32P] ATP to substrates per min at 30^.4. Ankyrin, CD44, PKC subcellular localizationThis assay was carried out by indirect immunofluorescence. HUVECs were fixed with 4% paraformaldehyde, followed by 5% Tritonx - 100 permeable treatment, later 10% BSA blocking. They were incubated with the first antibody at 4^ overnight, subsequently, stainded with the second antibody marked by fluorescein. The above samples were examined under the confocal laserscanning microscope.5. Ankyrin, CD44 protein expressionAnkyrin, CD44 protein expression were analysed by Western Blot. The im-munoreactive proteins were defected using an ECL detection system.6. CD44 adhesion modecules expressionHUVECs single cell suspension was incubated witn FITC - conjugated anti - CD44 antibody, and then analysed by flow cytometry. The FITC - conjugated unrelated isotype antibody acted as the negative control.7. HUVECs adhesion assayFiltered the human PRP labeled by ?1Cr through Sepharose 2B column, and then added it to the HUVECs grown on transwell upper side at 37 X for various time. Washed unadhesive platelets with PBS, and adhesive platelets were harvested and dissolved in 2% SDS solution, Liquid scintillation counting the CPM of unadhesive and adhesive platelets. The adhesive ratio was determined by the following formula.? . adhesive plateles cpm mA/wadhesion percentage = —-—;------:—:-----------c-------—c.------—------------x 100%adhesive platelets cpm + unadhesive platelets cpm8. HUVECs permeability assayTranswells with 1. OjxM pore size were inserted in 24 well culture plates, HUVECs were cultured up in serum free growth medium containing lmg/ml BSA to confluence on upper chamber of every well. Samples were taken from the lower chamber and determined BSA level.9. Raf - 1 kinase immunoprecipitationSupernatant containing target protein was incubated with anti - Raf - 1 kinase antibody for 2 hours at 4X. and rotary - mixed. lOjxl/sample protein G agarose beads were incubated with the above samples for 30minutes at 4X1. The beads were pelleted by centrifugation and washed in PBS buffer. The protein was released from the beads by boiling for 3 - 5 minutes with 2 x sample buffer (10%SDS, 10% 0 -mercaptoethanol, 16% sucrose, 0.1 M Tris - HC1, PH6. 8) , the supernatant was target protein.10. CD44 phosphorylated autoradiographyHUVECs were further cultured for 30 minutes at 31X in 5% CO2 after adding [r -32P] ATP. Ice cold PBS washed HUVECs for tree times, thenmixed HUVECs with buffer containing digitonin buffer ( 140mM NaCK25mM KCU5mM MgCK2mM EDTA^2mM EGTA^lOjxg/ml Leupeptin,20|xg/mlPep-stain.lmM Phenylme thysulfonyl - fluoride, PH7. 5 20mM Tris - HCKO. 5(xg/ ml Digitonin) for 5 minutes at 4X,, the above buffer containing 1% Triton X -100 was added to the pellet after centrifugation for 5 minutes at 4°C , and the supernatant containing protein was rotary mixed and analyzed by SDS - PAGE, followed by autoradiography.11. CD44 gene expressionThe total RNA was extracted according to the manufacture' s instruction to reverse transcribed and amplify CD44 sequence by RT - PCR. PCR condition was 94^ for 30 Seconds, 94X. for 50 Seconds, 52°C for 1 second, and 72 °C for i second; and [a -32P] dNTP (37MBq/jjJ) was added after 35 cycles, the products were electrophoresised on 12% SDS - PAGE and the band was qualified by autoradiography.12. CD44primer: designed for 233bpForward primer; 5' -CCAAGCCAT TCAAATCC -3',Reverse primer; 5' - rTGCCAAACCATTGTTCC -3'3 - actin - primer; designed for 690bpForward primer; 5' -CACCCTGTGCTGCTCACCGAGGCC -3'Reverse primer; 5 - CCACACAGATGACTTGCGCTCACG -3"12. Raf - 1 kinase activity assayThe extract of Raf - 1 kinase by immunoprecipitation was used for the Western Blot analysis. 70jxl protein was loaded onto 10% polyacrylamide gels, separated by SDS - PAGE, and subsequently electrotransferred to nitrocellulose membranes. Nonspecific protein - binding sites on the membrane were blocked with 5% dry skim milk in Tris - buffer with saline for 2h. The membrane was incubated with primary antibodies for 2h at 1:000 and incubated for 2h in secondary antibody ( 1; 2000 ) after washing the blot, and immunoreactive protein were defected using an ECL detection system.Results1. Dynamic trend of PKC activity in HUVECs treated by PMA and Calphos-tin CPKC activity in the plasma membrane fraction reached maximal level after exposure to lOng/ml PMA for 30 minutes, which significantly fell to the basal level after exposure for 24 hours. PKC activity in the plasma membrane fraction decreased to a minimum level after treatment with 0. 05 M Calphostin C for 1 hour, and maintained a lower level compared with untreated cells.2. Effect of PKC activity on distribution of CD44, ankyrin and PKC in HUVECsRedistribution and colocalization occurred in CD44, ankyrin. CD44 accumulated in a cap, in a small patch or in a single large aggregate on membrane as compared with homogeneous distribution previously, and PKC, ankyrin migrated in trie cytoplasm in accompany with CD44s movement, and just accumulated beneath the CD44 aggregates. 0. 05 M Calphostin C could restrain the above changes.3. Effect of PKC activity on CD44, ankyrin protein expression Expression of CD44, ankyrin protein was all enhanced by lOng/ml PMAstimulation, but 0. 05 M Calphostin C could suppress the protein expression of CD44 and ankyrin.4. Effect of PKC activity on adhesion of HUVECslOng/ml PMA resulted in the increased expression of CD44 as adhesive molecules and the increased adhesion percentage to platelets, which attached the maximal level at 2 hours and significantly decreased after 12 hours. 0.05 M Ca-phostin C could resist the above roles of PMA.5. Effect of PKC activity on HUVECs permeabilityHUVECs permeability started to increase after 30 minutes treatment with lOng/ml PMA. The interrelated analysis was made between percentage of PKC - ankyrin colocalization and permeability, or between HUVECs adhesion percentage and CD44 adhesion molecules expression. The related coefficent were0.938 and 0.963 respectively, all P <0.001.6. Effect of PKC activity on phosphorylation of CD44lOng/ml PMA treatment in HUVECs for lOminutes ~ 2hours resulted in a pronounced phosphorylation of CD44 protein, and 0. 05 M Calphostin C could inhibit the phosphorylation of CD44.7. Effect of PKC activity on CD44 gene expressionThe gene level of CD44 in HUVECs was enhanced by lOng/ml PMA treatment for only 1 minutes, Which reached a high level between 5minutes and 30 minutes, but 0. 05 M Calphostin C inhibited the above up - regulation role of PKC.8. Raf - 1 kinase activity determinationRaf - 1 kinase was obviously increased after exposure to lOng /ml PMA, and 0.05 M calphostin C could inhibit the role of PKC.9. Effect of activator of PKC, inhibitor of PKC, Raf - 1 kinase, MEK and ERK on CD44 gene expression level.CD44 gene expression level was obviously increased after treatment with lOng/ml PMA (PKC activator) , but 0. 05 M Calphostin C (PKC inhibitor) , 30 M RKIP (Raf - 1 kinase inhibitor) , 5 M PD98059 (MEK inhibitor), 10 M Genisetin ( ERK inhibitor) all could inhibit the up - regulation of PKC on CD44 gene.Conclusions1. PKC activity effected the expression of ankyrin and CD44 protein in vascular endothelial cells.PKC activation resulted in the synchronous subcellular redistribution and colocalization of PKC, CD44 and ankyrin. Ankyrin "s movement was related with the increased permeability of vascular endothelial cells.2. Normal expression of CD44 adhesion molecules depended on the intact of cytoskelton in vascular endothelial cells.3. PKC activation could up - regulate CD44 outer expression as adhesion molecules and enhanced the adhesive ability of vascular endothelial cells.