| IntroduceThe current surgical and chemotherapeutic therapies of human gastric carcinoma are often unsuccessful unless the tumor is detected at early stage. Peritoneal metastasis is the most common postoperative recurrence of gastric cancer with radical resection, which is one of the key factors affecting treatment effects of advanced gastric cancer. The perception of peritoneal seeding and the treatment of subclinical foci in peritoneal cavity have been known as the key subject of gastric cancer surgery in recent years, to which many authors have paid more attention. Despite the importance of peritoneal metastasis in mediating the morality of gastric carcinoma, little is known about the mechanism of this phenomenon. Peritoneal metastasis is regarded as a multistep process at present, which includes detachment of malignant cells from the primary tumor, transfer to the peritoneal cavity, attachment to the peritoneum, degradation of the extra cellular matrix (ECM) , and migration of the adhesive tumor cells into surrounding tissues. The complicated mechanisms for distant metastasis have been investigated by the method of molecular biology through the analysis of such metastasis processes as cell mobility, adhesion, invasion and growth stimulation. In these processes, adhesion molecules, matrix metalloproteinases, cytokines play an important role in peritoneal metastasis.LM reveal that the normal peritoneum and early gastric cancer patients peritoneum was composed of three layers: a single layer of flat mesothelial cells, a thin layer of submesothelial connective tissue consisting of collagen fiber oriented parallel to the peritoneal surface, and a laver of adipose tissue. In contrast, theperitoneum were found fibrosis, submesothelial connective tissue became thick, showing extensive proliferation of fibroblast. SEM reveal the nonnal peritoneum to be covered with mesothelial cells. These cells were so flat that detail of the cell bounderies were indiscernible. Whereas, the peritoneum with metastasis were quite different. The mesothelial cells were hemispherical, the cells were separated from each other and interconnected by a few bundle of fine cytoplastic processes.Transforming growth factor - p,is a family of 25 - kd homodimeric polypep-tides that were initially identified by their potential to induce growth of mesen-chymal cells in soft agar. TGF - fj, is a multipotent cytokine that delivers mainly cytostatic signals. This growth factor regulates cell growth and differentiation in both normal and transformed cells. It was found to inhibit the growth of normal cells. TGF - [B, generally enhances adhesion though increased matrix production and decreased proteolysis. The more aggressive form of tumors are growth — stimulated by TGF - |3,. Treatment of the murine mammary carcinomas with TGF - p, enhanced their invasion and the rate of pulmonary metastasis. Transforming growth factor - betal is an important mediator of the fibrosis process. High expression of TGF - betal is closely related to peritoneal fibrosis. Tumor cells that produce active TGF - j^make use of proteolysis coupled with motility to achieve invasion. TGF - (3, is a common occurrence during carcinogenic progression in many tissues, and elevated TGF - fj, expression almost invariably associates with indicators of poor prognosis, many studies reported that almost all cancer cells can secrete TGF - (3,, It has been shown that elevated levels of human TGF - Pi protein in cancer correlate with an increased metastatic potential. There is a significant correlation between tumor expression of TGF - {$, and a shorter post - operative survival, the expression of TGF - |3j was closely related to peritoneal metastasis or its related factors. TGF - (3j plays an important role in the process, it can enable mesothelial cells to deform and increase the expression adhesion molecules in cancers. In addition,TGF - {3,can depress the activity of immune cells, such as lymphocytes and macrophage.RNAi is arguably one of the great discoveries of humankind in recently. RNA interference and the described external guide sequences are importantmethods that use RNA to suppress gene expression in human cells. RNA interference (RNAi) , or RNA silencing, is triggered by siRNA, which can by generated in several ways. Long double - stranded RNA ( dsRNAs) molecules are processed into 21-23 nucleotide small interfering RNAs (siRNAs) by the Dicer enzyme ( a RNase III - like dsRNA - specific endonuclease, acting as a di-mer that cleaves both strands of dsRNAs leaving two - nucleotide, 3'overhanging ends). Alternatives are represented by exogenous siRNAs that can be provided as synthesized oligonucleotides or expressed from plasmid or viral vectors. siR-NA molecules are incorporated into the RNA - induced silencing complex ( RISC ) , that includes helicase, RecA, and exo - and endonucleases, as well as other proteins. Following its assembly, the RISC guides the RNA degradation machinery to the target mRNAs and cleaves it in a sequence - specific, siRNA - dependent manner. siRNA molecules for RNAi applications offer higher efficiency to suppress the expression of specific genes, compared with traditional antisense approaches.High expression of TGF - betal is closely related to peritoneal metastasis. RNA interference using short hairpin RNA ( shRNA) can mediate sequence -specific inhibition of gene expression in mammalian cells. The aim of this study was to assess the effect of shRNA targeting TGF - betal on the expression of TGF - betal in human peritoneal mesothelial cells and in human gastric cancer cell line SGC - 7901, which may provide a novel applicable strategy for gene targeted therapy of gastric cancer peritoneal metastasis.Material and Methods1. TGF - Pj siRNA expression vector constructionA vector used to transcribe functional short interfering RNA (siRNA) was constructed, and 62 mer oligonucleotide fragment was inserted into the downstream of the hU6 promoter. According to siRNA Design Support System, sequences targeting the TGF - betal were designed. To improve the silencing activity and to overcome technical obstacles described in the text, multiple C to T or A to G mutations were introduced within the sense strand of the hairpin loop.To construct hairpin - type single RNAi vectors, the synthesized sense and anti-sense oligonucleotides were annealed by incubation at 991 for 2 min, followed by rapid cooling to 12X, for 90 min, and ramp cooling to 30*t over a period of 2h, 4X1 store, the annealed oligonucleotides was ligated with pcPUR Pjicassette vector, The reaction mixture was electrophoresed, gel pieces containing the DNA fragments were excised and the DNA was purified using a EndoFree? Plas-mid MAXI Kit.2. Cell culture and transfectionThe gastric cancer cell line was maintained in RPMI - 1640 containing 10% fetal bovine serum (FBS) , gentamycin and penicillin at 37^ , 5%CO2 atmosphere. Conditional medium of NIH3T3 cells were prepared after centrifuga-tion and stored at -20T!. Human greater omenta was enzymatic disaggregated with 0. 2% trypsin -0. 02%ethylene diaminetetraacetic acid (EDTA) , and cultured after isolation from red blood cells. Cell growth under culture mediums contained 20% fetal bovine serum. Morphologic changes were deteted through downward microscope during cell culture. Morphologic types were observed by HE staining. The ultrastructure was observed by scanning electron microscopy ( SEM ) . Isolated cells were characterized by immunohistochemical analysis.Transfections were performed using So - fast ? Transfection Reagent, according to the manufacturers instructions. To establish cell lines stably expressing siRNA, we transfected TGF — (BjsiRNA plasmids into gastric cancer cells, and cultured cells in the presence of 1.25|xg/ml of puromycin. Colonies resistant to puromycin appeared within 2 weeks, after which the cells were expanded for another 3 weeks to make the original stock cells. At the same time, we transiently transfected mesothelial cells.3.RT-PCRTotal RNA from each group cells was independently extracted using Trizol Reagent, the total RNA was reverse - transcribed by using a Super Script Pre-amplification System for First Strand cDNA Synthesis Kit . PCR was carried out with the following primers: forward primer5'-CAACAATTCCTGGC GATACCT-CA - 3 ' and reverse primer 5 ' - ATCCACTTCCAGCCGAGGTCC TT - 3 '. TGF - p,primers was performed with 35 cycles at 94 XI for 30 sec, 57.51 for30 sec, and 72X1 forl min. A final 10 - min extension step was added after the last cycle, aliquot of the PCR product underwent electrophoresis on 15g/L agar-ose gel stained with ethidium bromide and was visualized under UV trans - illuminator.4. Western blotCells were harvested, protein samples were sonicated on ice , lysed 40 min at 4T1, then centrifuged 1500rpm/min, 30min at 4°C , transferred the supernatant to a new trip on ice and then calculated the amount of protein. Equal a-mounts of protein were electrophoresed, transferred to a NC membrane, the membrane was incubated in bloking solution contained 5% defatted milk powder 2h, then probed with rabbit anti - human TGF - fjj (1:200) overnight, and incubated with mouse anti rabbit ALP - IgG( 1:2000)2h, the membrane was then stained by ALP solution. The intergrated density value (IDV) of result was analyzed by fluorchem software.5. MTT assayCells were plated into 96 - well plates and cultured in lOOul RPMI -1640 medium, the unpretreated cells was considered as negative control. Tansfection 72h later, 50ul 3 - [4,5 - dimethylthiazol -2 -yl] -2,5 - diphenyltetrazolium bromide MTT was added to each well, incubated for 4h at 37X. and the for-manan crystals formed were dissolved in 150ul DMSO. the optical density was recorded at 490 nm on a microplate raeder.6. Cell cycle analysiscells were harvested and washed with ice - cold 70% PBS twice, centrifuged and supplemented with PI for 30 min in dark room at 4^. cell cycle was analyzed by flow cytometer and CELL QUEST software.7. Adhension ability and Invasion assay96 - well plate covered by Mouse tail gum was incubated at 4t, overnight, the pretreated cancer cells were added, then shaked at 37 T! for 30 min, 50 ul MTT was added to each well, incubated for 4h at 371 and the formanan crystals formed were dissolved in 150ul DMSO. the optical density was recorded at 490 nm on a microplate reader, the value of adhension ratio was calculated after three times repeat. The adhesion between peritoneal mesothelium cells andgastric cancer cell line SGC -7901 was assessed by 3H -TdR.A total of 2 x 10 cancer cells were added into the upper part of Millicell model with 8 um diameter, matrigel - coated polycarbonate membrane (8 jxm pore size) , then incubated at 37T!for 8h, Then the cells on the upper surface of the filter were wiped off using a cotton swab, and the cells that had invaded the underside of the filter were fixed in 95% alcohol for 30 min and stained by HE. and counted under bright - field microscopy at x200 magnification in five random fields of view. The experiments were repeated three times.8. Nude miceBALB/c nu/nu male nude mice were maintained free of specified pathogens using an Isorack in the experimental animal center. Mice were given sterile food and water adlibitum. Four - to - six - week - old mice weighing 20 to 22 g were used for the experiment. In experiment gastric cancer cells were injected intraperitoneally into nude mice. Six weeks after the inoculation, the mice were killed by draw neck sacrifice to observe form neoplasma, and abdominal membrane were stained by HE and scaned by scanning electron microscopy.Data were analyzed by t - test of spssl 1. 5 software.ResultsElectrophoresis and DNA sequencing confirmed that the TGF - (3j - specific siRNA was synthesized and coloned into the expression vector pcPUR - (3, ic-assette successfully. Immunohistochemical studies showed positive staining for cytokeratin and vimentin, but negative staining for leukocyte common antigen and factor VIII - related antigen in cultured mesothelial cells. Cultured cells were multipolar and presented a cobblestone - like appearance when they reached confluence. SEM verified the abundant microvilli on the surface of the cells. The TGF - PjinRNA and protein in these two cells could be remarkably suppressed at 72 hours after transfection of TGF — (3j siRNA in comparison with the respective untransfected group , especially protein. TGF - ($, protein in human gastric cancer cell line SGC -7901 was reduced about 65. 8% ,and about 61.8% in mesothelium cells, transfected mesothelium cells or gastric cancercells could be both remarkably decreased adhesive ability between mesothelium cells and SGC -7901. TGF - p, siRNA had great inhibitory effect on the growth of SGC -7901 cell and mesothelium cell, inhibition ratio(IR) was 30.18% and 33.22% ,cell proliferation was hold -back. Adhesion and invasion assay at the same time presented a decrease. The tumorigenic rate was also reduced in mice, expression of TGF - p, mRNA (0. 567 ± 0. 038 vs 0. 617 ± 0. 025 ) and protein (16. 33 ±4. 51 vs 41. 00 ±5.57) were notably inhibited in human gastric cancer cell line SGC - 7901 with stably expressing TGF - (3, siRNA compared with transient transfection. In addition, stably transfection has a advantage of transient transfection to suppress adhesion , invasion and tumorigenic ability of SGC -7901. At different pathologic state, abdominal membrane appearance occur-renced corresponding changes.Conclusion1. Trypsin - EDTA enzymatic disaggregation method is a simple, effective and repetitive protocal for isolation of human peritoneal mesothelial cells.2. Plasmid - based TGF - {3j siRNA can inhibited significantly TGF - (3, expression in human gastric cancer cell line SGC - 7901, and inhibit the adhesion, invasion and metastasis;3. TGF - Pi expression in human peritoneal mesothelium cells can be inhibited significantly using plasmid - based TGF - {3j siRNA, adhesion between SGC-7901 and mesothelium cells deceased, which may provide a novel applicable strategy for gene targeted therapy of gastric cancer peritoneal metastasis.4. Stably transfection TGF - ^ siRNA expression compared with transient transfection was more effective to inhibit the adhesion, invasion, and peritoneal metastasis.5. At different pathologic state, abdominal membrane appearance occur-renced corresponding changes. |