Dobutamine Increases Expression Of Aquaporin-5, CAMP Level And Enhance Alveolar Fluid Clearance In Acute Lung Injury Rats

AQP5 is a type of widely expressed water channel protein,and found in apical membrane of typeâ… alveolar epithelial cells where it can participate in respiratory tract water homeostasis.We examined the effects of dobutamine on alveolar fluid clearance as well as AQP5 expression and cAMP level in acute lung injury rats.Our studies indicate that dobatamine may enhance alveolar fluid reabsorption of alveolar epithelial cell under ALI by increasing AQP5 expression and cAMP level.Materials and MethodsAnimal ModelMale Wistar rats(3-4month old,300-350g)were obtained from Research Centre, Shengjing Hospital,China Medical University,and maintained in Research Centre with ad libitum water and food on a 12h:12h light-dark cycle with lights on at 07:00.32 rats were divided to four groups.Escherichia coli LPS(Sigma,USA)(10μg in 50μl 0.9%NaCl) was injected subcutaneously as 8mg/kg in two groups.Saline was injected in control groups under the same condition.Then Dobutamine(Shanghai First Biochemistry Pharmaceutical Industry Limited Company,China)(10ug/kg/min) were injected intravenously and constantly in two groups(one LPS treated group and one control group).Saline was injected in other two groups under the same condition.Data were collected during the same time of day for all groupsChemicalsDobutamine was bought from Shanghai First Biochemistry Pharmaceutical Industry Limited Company,China.Escherichia coli LPS was bought from Sigma,USA. Anti-aquaporin5 and anti-β-actin were bought from Alpha Diagnostic International, USA.Other chemicals were purchased from Wuhan Boster bio-engineering Limited Alveolar fluid clearance(AFC) measurementAll rats received humane care.Alveolar fluid clearance was measured in the isolated rat lungs in the absence of pulmonary perfusion or ventilation.Briefly, the rats were anesthetized with intraperitoneal pentobarbital sodium(50 mg/kg).An endotracheal tube was inserted through a tracheostomy.The rats were exsanguinated via the abdominal aorta and the trachea,bilateral lungs,and heart were excised en bloc through a median sternotomy.Warmed isotonic saline solution(7ml/kg,37℃) containing 5%bovine albumin was instilled into both lungs,followed by 4 ml oxygen to deliver all the instilled fluid into the alveolar spaces.The lungs were placed in a humid incubator at 37℃and inflated with 100%oxygen at an airway pressure of 7 cmH₂O.Alveolar fluid was aspirated 1 h after instillation.AFC was estimated by measuring the progressive increase in the concentrations of alveolar Evans blue dye.Briefly,a warmed saline solution(1.5 ml) containing 5% albumin and 0.15 mg/ml Evans blue dye was instilled into the right lung followed by 1 ml of oxygen to deliver all of the instilled fluid into the alveolar spaces.The lung was placed in a humid incubator at 37℃and was inflated with 100%oxygen at an airway pressure of 8 cmH₂O.Alveolar fluid was aspirated 1 h after instillation.AFC was calculated as followsAFC=[(Vi-Vf)/Vi]×100Where V is the volume of instilled albumin solution(i) and final alveolar fluid(f),and Vf=(Vi×EBi)/EBfwhere EB is the concentration of Evans blue dye in instilled albumin solution(i) and final alveolar fluid(f).RT-PCRTissue mRNA was reverse transcribed into cDNA using superscriptâ…¡Reverse transcriptase(Invitrogen) and oligo-dT(T18) primers(Promega,USA).Quantitative RT-PCR was performed on a LightCycler(Roche) using SYBR Green PCR Master Mix (Roche).Primers specific to the AQP5 andβ-Actin cDNA(Shanghai Genebase Gen-Tech Ltd,China) were used:AQP5-forward:5'TCCAGGACCACACCAGAAAGAQP5-reverse:5'ATAAAATAGCACTCCGTGAGCCβ-Actin-forward:5'GACTACCTCATGAAGATC β-Actin-reverse:5'-GATCCACATCTGCTGGAAThe results were normalized relative to theβ-Actin cDNA.Western blotTo perform protein extraction,we thawed and homogenized frozen lungs or cells in three volumes of lysis buffer[10 mM Tris(pH 7.4),150 mM NaCl,1%Triton X-100, 1%sodium deoxicolate,0.1%SDS,and 5 mM EDTA]containing a protease inhibitor cocktail,using a Polytron homogenizer.The homogenate was clarified by centrifugation, and the final protein concentration was determined.30μg of protein was separated on a 10%SDS polyacrylamide gel and electroblotted onto a polyvinylidene difluoride membrane.The blots were probed with anti-AQP5(1:1000) or anti-β-Actin(1:1000, Sigma) antibodies,membranes were incubated with horseradish peroxidase-conjugated secondary antibodies(1:2000) and visualized using a chemiluminescence detection reagent(Bio-rad).Quantification of blot density was performed by image software.cAMP measurementRats lungs were harvested as described above and then snap-frozen in liquid nitrogen either immediately or after 6 hours of immersion in preservation solution of the same composition as that used for harvest.Tissue was homogenized for 60 seconds at 4℃in Tris-buffered saline with 0.3mmol/L isobutylmethylxanthine(Sigma), followed by the addition of ice-cold trichloroacetic acid(6%) to further lyse cells and precipitate proteins.The trichloroacetic acid-soluble supernatant was removed from the well,extracted three times with water-saturated ether,and dried,and the pellet was resuspended in sodium acetate buffer(pH 6.2).A radioimmunoassay was then performed for cAMP as described.Protein content was determined by the method of Lowry after solubilizing trichloroacetic acid-precipitated protein with sodium hydroxide(1N).ResultsThe effect of dobutamine on the AFC in ALI ratsConstantly intravenous injected dobutamine significantly increased the AFC by about 70%in treated group compared to control groups.(Fig1A) In non-ALI groups dobutamine showed no significant effect on AFC.(Fig 1B)Dobntamine increased expression of AQP5 in both transcriptional and protein expression levelThe transcriptional level of AQP5 in dobutamine treated group was higher by 13-fold than the one in untreated group.(Fig 2A) Westem blot further proved the significant increment of AQP5 protein expression in dobutamine treated group.(Fig 2C) While in non-ALI groups,there was no significant difference either at the gene expression or the protein level between dobutamine treated or untreated groups.(Fig 2B,2C) Quantification of western blot was performed to verify the results.(Fig2D)Dobutamine increased the cAMP level in ALI ratsDobutamine significantly increased the cAMP level dobutamine treated group by around 7 folds compared to untreated group.(Fig3A) The enhancement of CAMP level by dobutamine was also observed in non-ALI groups,but the folds decreased to around 2.(FigaB)DiscussionAFC in patients with ALI and ARDS is impaired in the majority of patients,and maximal alveolar fluid clearance is associated with better clinical outcomes.β-adrenergic agonists are known to stimulate sodium transport and fluid clearance in the alveolar epithelium.Dobutamine,as a widely used clinicalβ-adrenergic agonist, increases alveolar liquid clearance in ventilated rats,here we provided the evidence that dobutamine enhances AFC and up-regulated AQP5 expression and cAMP levels simultaneously in ALI rat model.However,dobutamine seemed no effect on AFC of healthy rat lung,which implied the separated response of AQP5 to different condition of AFC.The function of AQP5 in the AFC of post- ALI is still in argument.Some report suggested that AQP5 might play a role in abnormal fluid transportation and probably involve in the formation of pulmonary edema in ALI/ARDS,while other study shows negative correlation.Here we confirmed the up-regulation of AQP5 expression in response to dobutamine treatment only in ALI rats,which suggested that AQP5 may play an additional important role in injury-responded remedy process.It is known that AQP5 plays a fundamental role in regulation of airway submucosal gland secretion.However,the contribution of AQP5 to the molecular details of chloride and sodium transport has not been defined in ALI,although described primarily in the context of cystic fibrosis.The best-defined example of cAMP regulation of a water channel protein is that of AQP2 in rental cells.Within the aquaporin family,AQP5 is most similar genetically to AQP2.cAMP also has been reported to regulate the distribution and abundance of AQP5 in lung epithelial cell,and cAMP level can be regulated byβ-adrenergic agonists.Short term(minutes) exposure to cAMP produces intemalization of AQP5 off the membrane and a decrease in protein abundance,while long term cAMP exposure(hours) produces an increase in membrane localization and increased abundance.Both of these responses were blocked by inhibition of protein kinase A.In our study,we observed increasing cAMP level at least 1 hour after the constant dobutamine treatment,which implies sustained in vivo cAMP level induced by dobutamine.In addition,the up-regulation seemed also determined by the intensity of cAMP increment for the little alteration of AQP5 level by slight cAMP enhancement in non-ALI rat groups.This dynamic regulation of cAMP-AQP5 by dobutamine may contribute some clinical significance in ALI therapy.ConclusionIn conclusion,our study showed constantly intravenous injection of dobutamine could induce increasing of AFC,as well as AQP5 expression and cAMP production in ALI rat model,which suggested that the effect of dobutamine on AFC might include AQP5 and cAMP as the important regulating points.Further exploitation of both the mechanisms and physiologic implications of this regulation may provide insights into novel targets for therapy in ALI.