The Study Of Subcellular PTEN Radiosensensitizes Glioma Cells

Tumor is great threat to human health. Current treatments include surgery, radiotherapy, chemotherapy, gene therapy and biological therapy. Due to the absence of respectivity, these current treatments can bring about some side effects. Then, these current treatments have dose limitation and effection limitation. Nowadays cooperative treatments are the standars of tumor therapy. About 70% tumor patients need the radiotherapy. Gene therapy combination with radiotherapy can radiosensitize the tumor cells. PTEN is a tumor suppressor gene estimated to be inactivated in 50%-80% of solid tumor cells, Wick transduce PTEN gene into low-expression tumor cells, can elevate the radiosensitivity. Specifically, PTEN is predominantly localized to the nucleus in primary, differentiated and resting cells, compared to rapidly cycling cancer lines where in many cases there is a marked reduction of nuclear PTEN. In this research, we incorpated the nuclear located signals into PTEN sequence then conducted to determine whether Nuclear PTEN can radiosensitize the U251 cell line in which the PTEN is less expressed. .In this way, we may provide a promising way for tumor treatment.1 Construction of recombinant plasmids1.1 Acquisition of human wildtype PTEN sequenceRNA is extracted from the placenta, the specific PCR primers were designed according to the sequence of PTEN gene:upstream 5-CGCGGATCCA GACAGCCATCAT CAAA GAG-3'including EcoRI enzyme digestion sites, downstream 5'-GGGCCGGAATTT CAGACT TTTGTAATTTGTG-3'including BamHI enzyme digestion sites. The PTEN gene was identified by cleavage of endonucleases and sequencing process.The results of identification confirmed that the sequence of the cloned gene was identical to that published on Genbank.1.2 Acquisition of NSL PTEN sequenceNSL-PTEN were constructed by using the PCR strategy for incorporating the nuclear signal: upstream 5- CGCGGATCCATGTCCTCTGCGTTGTCTGCGTATCCTCTTCTTTCGTCACAGCCATCATC-3'including EcoRI enzyme digestion sites, The PTEN gene was identified by cleavage of endonucleases and sequencing process. The results of identification confirmed that the sequence of the cloned gene was identical to that published on Genbank.1.3 Construction of recombinant plasmidsNSL-PTEN and PTEN were ligated to pcDNA3.1 to construct The pcDNA3.1- PTEN and pcDNA3.1-NSL-PTEN plasmids. In the following experiments, the expression rule of these plasmids in human glioma cell line U251, and their effects on the DSB repair, apoptosis and cell cycle of the two cell lines were detected.2 Experimental grouping and index detectionThe experiment was divided into four groups which were the control, pshuttle, PTEN, NSL-PTEN groups. The irradiation dose was 2.0 Gy. flow cytometry was used to detect cell cycle and apoptosis. DNA damage was checked byγ-H2AX, protein expression level was detected by Westernblot.3 protein expression levelThe cells and supernatant were harvested in different time after 4.0 Gyγ-irradiation. In PTEN, NSL-PTEN groups, PTEN protein increased significantly compared with control, pshuttle groups. In PTEN, NSL-PTEN groups, P53 protein increased significantly compared with control, pshuttle groups. In PTEN, NSL-PTEN groups,cyclin D1 protein decreased significantly compared with control, pshuttle groups. PKC protein expresses constantly. P-PKC protein expresses constantly before radiation. P-PKC protein increased significantly in 15 minutes. P-PKC protein decreased significantly in PTEN, NSL-PTEN groups.4 Effect of DNA damageThe cells were irradiated with 4.0 Gy at 24h after transfection. DSB repair was delay in PTEN, NSL-PTEN groups.5 Effects of cell cycle combining recombinant plasmids andγ-irradiation on U251 cellsThe cells were irradiated with 4.0 Gy at 24h after transfection,then harvested 12 h,24h,48h, later.In PTEN, NSL-PTEN groups, the percentage of G1 increase significantly before radiation. In PTEN, NSL-PTEN groups, the percentage of G2/M increase significantly after radiation6 Effects of cell apoptosis combining recombinant plasmids andγ-irradiation on U251 cellsThe cells were irradiated with 4.0 Gy at 24h after transfection,then harvested 12 h,24h,48h, later.In PTEN, NSL-PTEN groups, the percentage of apoptosis increase significantly before radiation and adter radiation7 Effects of cell proliferation measured by MTTThe cells were irradiated with 4.0 Gy at 24h after transfection,then harvested 24h,48h, 72 h later. The OD were measured by MTT. the PTEN and NSL-PTEN groups decrease significantly before radiation and adter radiation.8 Conclusionthe PTEN and NSL-PTEN can resist tumor cell through modulation of cell cycle, apoptosis, delay of DSB repair, and impairment of proliferation. The NSL-PTEN may play the key role at the function of PTEN resistance of tumor.