The Methylation Status Of PTEN Gene In Adenoid Cystic Carcinoma Cells

IntroductionSalivary adenoid cystic carcinoma is one of the most common salivary gland malignancies and the most common cause of cancer-related death worldwide in oral. At present, the biological mechanism on the proliferation, differentiation, invasion and metastasis of salivary adenoid cystic carcinoma is not yet very clear. It has been reported a variety of oncogenes including c-erbB-2, c-myc, ras, bcl-2, are associated with adenoid cystic carcinoma. In addition, studies have reported the tumor suppressor gene p53 is involved in the pathogenesis of salivary adenoid cystic carcinoma. However, Different from its lower expression in many other tumors, the higher expression of p53 in salivary adenoid cystic carcinoma could be observed, which indicated that it can not serve as a diagnostic marker of salivary gland tumors.Phosphatase and tension homology deleted on chromosome 10 (PTEN), a tumor suppressor, that regulates multiple cellular functions, including cell growth and survival, differentiation and proliferation, apoptosis, focal adhesion, invasion, migration as well as angiogenesis, is frequently deficient in various tumors due to mutation or epigenetic alterations. PTEN promoter hypermethylation is a major epigenetic silencing mechanism leading to its low expression in tumors. Recent studies have shown that the abnormal expression of PTEN in oral and maxillofacial tumors is related with the occurrence, development and invasion of tumors. The high expression of PTEN in normal salivary gland and low expression in the adenoid cystic carcinoma also can be observed, but its molecular mechanism is unclear. In this study, whether PTEN promoter methylation is involved in the regulation of PTEN gene in the adenoid cystic carcinoma cells has been focused on. The different expression of PTEN in normal salivary gland epithelial cells and the adenoid cystic carcinoma cells, ACC-2 cells was at first observed, the different methylation status of PTEN promoter region in these two cell lines was then identified, and the changes of PTEN expression in ACC-2 cells treated with DNA methylation inhibitor, 5-Aza-2-deoxycytidine, were analyzed. Our study presented here suggests that the hypermethylation of PTEN gene promoter region should lead to lower expression of PTEN gene in the adenoid cystic carcinoma cells, which is helpful to explore the function of the PTEN gene methylation status in the pathogenesis of the salivary adenoid cystic carcinoma and development of PTEN gene as a molecular marker for early diagnosis of this carcinoma. Materials and methodsCell Lines and Culture Conditions. Normal salivary gland epithelial cells were grown from salivary gland epithelium that was harvested from fresh surgical specimens obtained from patients undergoing lobectomy procedures. The mucosal layer was sterilely stripped from salivary gland, cut into small pieces, and placed on a plastic tissue culture plate containing a thin layer of medium. For each experiment, normal salivary gland epithelial cells from a single patient were used. Normal salivary gland epithelial cells were grown in DMEM (Hyclone, Logan, UT) on standard plastic ware (Becton-Dickinson, Bedford, MA) at 37°C in a 5% CO2 atmosphere. The ACC-2 cell lines were routinely maintained in RPMI 1640 supplemented with 10% FBS. The ACC-2 cell lines were obtained from West China College of Stomatology, Sichuan University.5-Aza-2-deoxycytidine was added to the RPMI 1640 containing 10% serum.Genomic DNA Extractin and Bisulfite Modification. Genomic DNA was extracted from normal salivary gland epithelial cells and ACC-2 cell lines using the PureLink? Genomic DNA kit (Invitrogen, Carlsbad, CA). DNA (1μg)was denatured with 3 mol/L NaOH at 50°C for 10 minutes followed by incubation with 3.3 mol/L sodium bisulfite and 10 mmol/L hydroquinone at 55°C for 16 hours, which converts all unmethylated cytosine residues to uracil. The modified DNA was purified by using a NucleoSpin Extract II kit (Macherey-nagel, Dueren, Germany).The eluted DNA was suspended in 25μL H2O and stored at -80°C until polymerase chain reactin. Methylation-Specific Polymerase Chain Reactin. Two primer sets were used to amplify the PTEN promoter region from -2262 to -2242 nucleotides upstream of the translation start site that incorporated a number of CpG sites, one specific for the methylated sequence (PTEN-M, Left primer:5′- TTAGATAGGTGTTTTTTGGGTTTTT-3′Right primer: 5′- CCCCCAAATCTATATCCTCATAATAT -3′) and the other for the unmethylated sequence (PTEN-UM, Left primer:5′- TTAGATAGGTGCCCTTTGGGCCCTTG -3′Right primer: 5′- CCCCCAAATCTGTGTCCTCATGGTGT -3′). The primers used in the present study detect specifically the promoter sequence of the PTEN gene rather than that of the PTEN pseudogene. The polymerase chain reactin for PTEN-UM and PTEN-M were carried out in a 50μl volume containing 1×polymerase chain reactin buffer (15 mmol/L MgCl2), 2.5 mmol/L mixture of dNTPs, 10 pM of each primer, 5U HotStart Taq DNA polymerase (Qiagen, Valencia, CA), and 25 to 50 ng of bisulfite-modified DNA. Amplification was performed in a thermocycler with the following conditions:94°C for 5 minutes, cycled at 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds (38 cycles) followed by extension at 72°C for 5 minutes.Direct sequence analysis. The product of MSP amplification is purified according to Omega's DNA gel extractin kit instructions. The recovered DNA fragment is inserted into the pMD18-T vector and then transformed into E. coli DH5α. The positive clones were screened by restriction enzyme digestion, and then sent to sequence (Ying-chun, Shanghai, China).Western Blot Analysis. Whole-cell lysates were prepared in lysis buffer [50 mM HEPES (pH 7.5), 150 mM NaCl, 1.5 mM MgCl2, 1 mM EDTA, 0.2 mM EGTA, 1% NP40, 10% glycerol, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 20 mM sodium fluoride, 5 mM sodium orthovanadate, 10 mg/ml aprotinin, 10μg/ml leupeptin, 2 mg/ml pepstatin, and 1mM benzamidine]. Lysates were incubated for 20 min on ice and centrifugated at 12,000×g for 15 min. The supernatants were collected, and the protein concentration was determined with a protein assay kit (Bio-Rad, Hercules, CA). Cell lysates were electrophoresed using SDS-PAGE and then transferred onto a PVDF membrane (Millipore, Billerica, MA). Membranes were immunoblotted overnight at 4°C with a rabbit polyclonal antibody against human PTEN (Cell Signaling, Boston, MA) and a goat antibody againstβ-actin (Cell Signaling) in Tris-buffered saline containing 5% nonfat dry milk. Antibody binding was detected using the ECL kit (Amersham Life Sciences, Buckinghamshire, UK) according to the manufacturer's directions.5-Aza-2_-deoxycytidine Treatment and RT-PCR. ACC-2 cell lines were transferred onto a 100-mm3 dish and, 1 day later,10μM 5-Aza-2_-deoxycytidine were added in RPMI 1640 containing 10% FBS. Cells were changed to a new medium containing 5-aza-2_-deoxycytidine every day. After 24hours, 48hours, 72hours of treatment, the cells were lysed in RNAisoTM Plus, and total cellular RNA was extracted. RNA was subjected to electrophoresis (20μg/lane) on a 1% agarose gel, the reverse transcription for RNA was carried out in a 10μl volume containing PrimeScript? RTase, 5×PrimeScript? Buffer, dNTP Mixture, Oligo dT Primer(50μM), Random 6 mers(50μM), RNase free H2O(Qiagen), and 25 to 50 ng of RNA . Reverse transcription was performed in a thermocycler with the following conditions:37°C for 15 minutes, , 85°C for 15 seconds. The primers (PTEN-1, Left primer:5′- ACCAGGACCAGAGGAAACCT-3′Right primer: 5′-GCTAGCCTCTGGATTTGACG -3′) used in study detect the expression of the PTEN gene. The polymerase chain reactin for PTEN-1 were carried out in a 25μl volume containing 1×polymerase chain reactin buffer (15 mmol/L MgCl2), 2.5 mmol/L mixture of dNTPs, 10 pM of each primer, 5U HotStart Taq DNA polymerase (Qiagen), and 25 to 50 ng of cDNA. Amplification was performed in a thermocycler with the following conditions:94°C for 5 minutes, cycled at 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds (38 cycles) followed by extension at 72°C for 5 minutes.Statistical Analysis. Statistically significant differences were assessed using a Analysis of variance. P < 0.05 was considered to be statistically significant.ResultsExpression of PTEN in the normal salivary gland epithelial cells and ACC-2 cells. RT-PCR analysis showed that the expression of PTEN in ACC-2 cells was significantly lower than that in the normal salivary gland epithelial cells. Prediction of CpG islands in PTEN promoter region. Using the MethPrimer program ( http:/ /www.urogene.org/methp rimer/ ), the distribution of CpG islands in about 3kb region upstream of the transcription start site of PTEN was predicted. Six potential CpG islands were found in the promoter region of PTEN, which were localized at -1190 to -1064, -1769 to -1545, -2208to -1809, -2405 to -2240, and -2866 to - 2766 nucleotides upstream of the translation start site, respectively.Methlylation status of PTEN in the normal salivary gland epithelial cells and ACC-2 cells. Using the DNA extracted from the normal salivary gland epithelial cells and ACC-2 cells as templetes, two pair primers, the methlyation-specific primer (M) and non-methylation primer(UM) were used to amplify the PTEN promoter region from -2262 to -2242 nucleotides upstream of the translation start site that incorporated a number of CpG sites, two fragments with expected sizes of 221bp could be amplified by MSP or regular RT-PCR.The MSP product was subcloned into the T vector and used for direct sequence analysis. The methylation frequencies of 4.8% could be occurred in this region in ACC-2 cells.However, no methylation CpG site could be found in the same region in the normal salivary gland epithelial cells.Effect of 5-Aza-2-deoxycytidine treatment on PTEN expression in ACC-2 cells. ACC-2 cells were treated without or with 5-Aza-2_-deoxycytidine for 24h, 48h and 72h, the RNAs and whole-cell lysates were extracted from the cells and RT-PCR and western blot analysis were preformed. Compaired with the control, the levels of mRNA and protein expression in the treated ACC-2 cells were found to be increased in a time-dependent manner.Conclusion:our study demonstrates that the hypermethylation of PTEN promoter region is one of the major mechanisms leading to lower expression of PTEN in the adenoid cystic carcinoma, which indicates that PTEN could be one of important candidate genes involved in pathogenesis of adenoid cystic carcinoma. This study provides a basis for development of PTEN as a molecular marker for early diagnosis of adenoid cystic carcinoma.