Study On IncRNAs Hotair In The Mechanism Of Immunologic Escape Of Gastric Cancer

Recent studies have shown that the long non-coding RNA (IncRNAs) HOTAIR plays critical roles in tumor biology, including cancer progression and metastasis. However, the potential biological role HOTAIR in tumor escape remains undefined.Here, HOTAIR expression was measured in sixty paired gastric cancer (GC) tissue samples by real-time PCR, and then subjected to correlation analysis with human leukocyte antigen (HLA)-G levels which show close links with tumor escape mechanisms. Significant HOTAIR overexpression was observed in GC tissues, as well as strong positive correlations with HLA-G levels in both tissue and peripheral blood samples, detected by real-time PCR and ELISA assays respectively. Futher gain-and-loss-of-function studies indicated that HLA-G could be upregulated HOTAIR at both mRNA and secretion levels in vitro. On the other hand, bioinformatics analysis indicated the interaction between HOTAIR and miR-152, which shows potential regulation on HLA-G. And, altered miR-152 expression in GC tissues was also identified, and showed negative correlation with HOTAIR expression. Moreover, the negative regulation of miR-152 on HLA-G was verified in GC cells, while miR-152 induced decrease of HLA-G 3’UTR activity could be attenuated by HOTAIR co-overexpression with the assistant of mutation studies.Therefore, it was concluded that HOTAIR overexpression might also get involved in tumor escape mechanisms, involving HLA-G upregulation via inhibiting miR-152.Furthermore this study recommended the potential application of HOTAIR in GC immunotherapy for better prognosis and improved survival.PART ONEThe expression and the role of IncRNAs HOTAIR in GC tissuesObjectivesTo investigate the expression of long non-conding RNA HOTAIR in GC tissues.MethodsSixty GC tissues and matched adjacent tissue samples were collected from 60 patients who underwent surgical resection for GC at Qilu Hospital of Shandong University from January 2013 to August 2013. And, corresponding peripheral blood samples were also collected one day before surgery. Written informed consent was obtained from each patient and the work was approved by local Ethics Committee.1. The detection of HOTAIR, miR-152 and HLA-G expression in GC tissues and matched adjacent tissue samplesSixty GC tissues and matched adjacent tissue samples were collected and frozen at -80℃ until use. Total RNA was isolated from tissues using Trizol. For the detection of HLA-G mRNA and HOTAIR, RNA was reverse transcribed into cDNA primed by oligo-dT primers using SuperScript Ⅲ Reverse Transcriptase, following the manufacturer’s instructions, with GAPDH used as endogenous control. For the detection of mature miR-152, the enrichment of small RNA was carried out with the mirVana miRNA Isolation Kit, with Small nuclear RNA U6 as control. Quantitative real-time PCR(qRT-PCR) was performed on ABI 7300 SYBR Premix Ex Taq from Takara. Data analysis was done by the △CT method for relative quantification.2. The detection of soluble HLA-G concentration in corresponding peripheral blood samplesThe corresponding peripheral blood samples were for EDTA-plasma preparation and frozen at -80 ℃ until use. EDTA-plasma samples after 48h incubation in serum-free medium were prepared for ELISA assays. Soluble HLA-G concentration was measured using sHLA-G kit according to the manufacturer’s instructions. Three independent experiments were repeated for each point.3. Bioinformatics analysis for the interaction between HOTAIR transcript and miR-152In silico prediction of the interaction between HOTAIR transcript and miR-152 was performed using DIANA TOOLS.4. Statistical analysisThe results are presented as mean±SD. Correlations were evaluated by Pearson’s correlation. Differences between groups were analyzed using a one-way ANOVA or χ2 test. Statistical analyses were performed using SPSS 17.0 computer software. And, P <0.05 was considered statistically significant.Results1.1.76-fold increase of HOTAIR expression in GC tissues as compared to matched adjacent tissues.2. Pearson’s correlation analysis showed a strong positive relationship between HOTAIR and HLA-G expression (R2=0.57), while similar results was also observed for HOTAIR expression and HLA-G concentration (R2=0.582).3. There were three potential binding domains within HOTAIR transcripts and miR-152, while "GCACUG" as common sequences module within tbese binding domains was replaced by "AAGAGA" to emerge a new Mut-HOTAIR transcript for following mutation studies.4.36-percent decrease of miR-152 expression in GC tissues as compared to matched adjacent tissues. Correlation analysis showed a strong negative relationship between HOTAIR and miR-152 expression (R2=0.5168).Conclusion1. HOTAIR expression showed significant upregulation in GC tissues.2. HOTAIR expression showed positive correlation with HLA-G expression in GC tissues and concentration in peripheral blood. These results implied that HOTAIR might regulate HLA-G expression in GC carcinogenesis.3. There were three potential binding domains within HOTAIR transcripts and miR-152, while "GCACUG" as common sequences module within these binding domains was replaced by "AAGAGA" to emerge a new Mut-HOTAIR transcript for following mutation studies.4. Decreased expression of miR-152 was detected in GC tissues. Correlation analysis showed a strong negative relationship between HOTAIR and miR-152 expression, indicating that abnormal HOTAIR expression might also lead to miR-152 dysregulation due to their interactions.PART TWOThe role of IncRNAs HOTAIR in tumor escape mechanisms of GC cellsObjectivesTo investigate the role of Long non-coding RNA HOTAIR in tumor escape mechanisms.Methods1. Cell cultureTwo human GC cell lines, SGC7901 and MGC-803, were obtained from the Chinese Academy of Sciences, and cultured in RMPI-1640 medium, supplemented with 10% FBS and antibiotics (1% streptomycin/penicillin) at 37℃ in a humidified atmosphere of 5% CO2.2. Plasmids and small interfering RNAs (siRNAs)HOTAIR overexpression plasmid was constructed using pCDNA3.1 vector with inserted human full-length HOTAIR cDNA, that synthesized with primers (forward: 5’-CCAGTTCTCAGGCGAGAGCC-3’; reverse:5’-TTTATATTCAGGACATGTAA-3). Mutation in the HOTAIR binding-sites module of miR-152 was introduced by site-directed mutagenesis, resulting in Mut-HOTAIR overexpression plasmid. All plasmid vectors for transfection were extracted by DNA Midiprep kit. Small interfering RNAs (siRNAs) and scrambled negative control siRNA (si-NC) that purchased from Invitrogen were used for HOTAIR inhibition. The sequences of three individual HOTAIR siRNAs are as follws:siHOTAIR-1:GAACGGGAGUACAGAGAGAUU; siHOTAIR-2:CCACAUGAACGCCCAGAGAUU; siHOTAIR-3: UAACAAGACCAGAGAGCUGUU.3. Cell transfectionMiR-152 mimics and inhibitor with relative negative control RNA were obtained from GenePharma. SGC7901 and MGC-803 cells (2.5×105) were plated in 6-well culture plates and transfected after incubation for 24h. Plasmid, siHOTAIR, miR-152 mimics or inhibitor was introduced into GC cells respectively using Lipofectamine2000 in Opti-MEM medium according to the manufacturer’s instructions.4. The detection of HOTAIR, miR-152 and HLA-G expression in GC cells after transfectionTotal RNA was isolated from cells using Trizol. For the detection of HLA-G mRNA and HOTAIR, RNA was reverse transcribed into cDNA primed by oligo-dT primers using Superscript Ⅲ Reverse Transcriptase, following the manufacturer’s instructions, with GAPDH used as endogenous control. For the detection of mature miR-152, the enrichment of small RNA was carried out with the mirVana miRNA Isolation Kit, with Small nuclear RNA U6 as control. Quantitative real-time PCR (qRT-PCR) was performed on ABI 7300 SYBR Premix Ex Taq from Takara. Data analysis was done by the △CT method for relative quantification.5. The detection of soluble HLA-G concentration in GC cells after transfectionCell culture supernatants after 48h incubation in serum-free medium were prepared for ELISA assays. Soluble HLA-G concentration was measured using sHLA-G kit according to the manufacturer’s instructions. Three independent experiments were repeated for each point.6. Luciferase assayA Firefly luciferase reporter comprising 3’UTR of HLA-G was generated using pGL3 vector and amplified cDNA of HLA-G 3’UTR with the following primers: HLA-G-3’UTR-forward:5’-GGGGTACCGATGGGTGAGTTCAACGAGA-3’; HLA-G-3’UTR-reverse:5’-CCCTCGAGAGGGTGGGTGTCATCAGG-3’.Then, pGL3-HLA-G was co-transfected with plasmid, siHOTAIR, miR-152 mimics or inhibitor for luciferase reporter assay. After 24h incubation, luciferase activity was measured using the Dual Luciferase Reporter 1000 Assay System.7. Statistical analysisThe results are presented as mean±SD. Correlations were evaluated by Pearson’s correlation. Differences between groups were analyzed using a one-way ANOVA or χ2 test. Statistical analyses were performed using SPSS 17.0 computer software. And, P < 0.05 was considered statistically significant.Results1. HOTAIR expression was dysregulated by HOTAIR overexpression plasmid or siHOTAIR transfection in both SGC7901 and MGC-803 cells.16.1-fold increase or 63-percent decrease of HOTAIR expression was verified in HOTAIR overexpression or inhibiting SGC7901 cells respectively, while 16.1-fold increase or 63-percent decrease was observed in corresponding MGC-803 cells.2. HLA-G expression and secretion were both detected by HOTAIR overexpression plasmid or siHOTAIR transfection in both SGC7901 and MGC-803 cells. Approximate 2-fold increase or 50-percent decrease of HLA-G expression was detected in HOTAIR overexpression or inhibiting SGC7901 cells respectively, while HLA-G secretion showed similar variation trend in corresponding cell culture supernatants.2-fold increase or 50-percent decrease was observed in corresponding MGC-803 cells.3. MiR-152 expression was detected in HOTAIR overexpression or inhibiting cells. Results showed that approximate 52-percent decrease or 1.72-fold increase of miR-152 expression was detected in HOTAIR overexpression or inhibiting cells respectively, while Mut-HOTAIR showed no significant effect on miR-152 downregulation. As positive control, approximate 17.3-fold increase or 67-percent decrease of miR-152 expression was detected in miR-152 mimics or inhibitor cells respectively.4. The regulation of miR-152 or HOTAIR on HLA-G expression was compared through gain-and-loss-of-function studies. Approximate 52-percent decrease or 2.2-fold increase of HLA-G expression was detected in miR-152 mimics or inhibitor cells respectively, while HLA-G secretion showed similar variation trend in corresponding cell culture supernatants. As positive control, approximate 1.8-fold increase or 47-percent decrease of HLA-G expression was detected in HOTAIR overexpression or inhibiting cells respectively. However, Mut-HOTAIR showed no significant effect on HLA-G expression and secretion.5. Luciferase activity was measured using the Dual Luciferase Reporter 1000 Assay System. Approximate 51-percent decrease or 1.75-fold increase of HLA-G 3’UTR activity was detected in miR-152 mimics or inhibitor cells respectively. Approximate 1.53-fold increase or 48-percent decrease of HLA-G 3’UTR activity was detected in HOTAIR overexpression or inhibiting cells respectively, while mut-HOTAIR overexpression showed no obvious effect. Approximate 1.2-percent decrease or 52-percent decrease of HLA-G 3’UTR activity was detected in miR-152 mimics+HOTAIR-plasmid or miR-152 mimics+mut-HOTAIR-plasmid cells respectively.Conclusion1. HOTAIR promoted HLA-G expression in GC cells.2. HOTAIR showed direct interaction with miR-152 and negative regulation on miR-152 expression in GC cells.3. Relative expression, concentration, or 3’UTR activity of HLA-G was consistently downregulated or upregulated by miR-152 or HOTAIR respectively, but not modulated by Mut-HOTAIR. Furthermore, miR-152-induced downregulation of HLA-G 3’UTR activity could only be reversed by HOTAIR overexpression, while Mut-HOTAIR overexpression also showed no obvious effect. These results showed that HOTAIR-induced downregulation of miR-152 attenuated the post-transcription regulation of miR-152 on HLA-G, contributing to HLA-G upregulation.