| Part one: Expression of FTO in human breast cancer tissues and its clinical significanceObjective:To investigate the expression of FTO in human breast cancer tissues and its relationships with the clinicopathological features, such as body mass index(BMI), tumor stage, tumor grading, lymph node metastasis, hormone receptor status, etc.Methods: 1. Sample collection: This retrospective study included 79 consecutive patients(all women) with invasive ductal carcinoma of breast at the First Affiliated Hospital, Guangxi Medical University, China between January 2012 and December 2013, 43 patients in whom juxta-tumor tissues were obtained. All tissues used were from mastectomy without any cancer treatment before. And the tumor specimens were all diagnosed by the pathologist.2. Immunohistochemistry was used to detect the expression of FTO in 79 cases of breast cancer tissues and 43 cases of the adjacent breast tissues. Statistical analysis was performed to assess the association between FTO expression and the clinicopathological features of breast cancer.Results:1. Expression of FTO in different breast tissues: FTO was expressed in both mammary epithelial and breast cancer tissues, but with different degree. The intensity of tissue staining for FTO in breast cancer was significantly higher than that in juxta-tumor tissue(78.5% vs 27.9%, p<0.001).2. Relationships between FTO expression and clinicopathological features in breast cancer: The percentage of FTO-positive expression in cases with hormone receptor(HR) negative(89.3%) and HER-2 amplification(97.2%) was significantly higher than that in those with HR positive(52.2%) and HER-2 negative(63.7%), respectively(p=0.001, p<0.001). The positivity rate of FTO in breast cancer with P53 positive(90.9%) and histological grade 3(100%) seemed to be higher than that with P53 negative(73.8%) and histological grade 1 or 2(75%), respectively. However, the p value did not reach the significant level(p=0.077, p=0.082). There was no association between FTO expression and age, T stage, LN status, TNM stage, Ki67, and BMI in breast cancer, respectively.3. FTO expression in molecular subtypes of breast cancer: The expression of FTO in HER-2-overexpressed subtype(97.1%) was significantly higher than that in Triple-negative(76.2%) and Luminal A/B1 subtypes(52.2%)(p<0.001).Conclusion:1. The expression levels of FTO in breast cancer tissues were significantly higher than that in the adjacent breast tissues. The percentage of FTO-positive expression in cases with hormone receptor(HR) negative and HER-2 amplification was significantly higher than that in those with HR positive and HER-2 negative. The positivity rate of FTO in breast cancer with P53 positive and histological grade 3 seemed to be higher than that with P53 negative and histological grade 1 or 2, respectively.2. FTO expression in HER-2-overexpressed subtype was significantly higher than that in Triple-negative and Luminal A/B1 subtypes.3. Our study indicated that FTO expression may have a vital role in the carcinogenesis of breast cancer, especially in HER-2-overexpressed breast cancer.Part two: The expression of FTO in human breast cancer cell lines MCF-7, SK-BR-3, MDA-MB-231 and mammary epithelial cell HBL-100Objective:To detect the expression of FTO in human breast cancer cell lines of different molecular subtypes, and select the one which FTO expressed higher for further biological function tests.Methods:1. Western blot was performed to examine FTO protein expression in human breast cancer cell lines MCF-7, SK-BR-3, MDA-MB-231 and mammary epithelial cell HBL-100, respectively. 2. Real-time PCR was conducted to examine FTO m RNA expression levels in human breast cancer cell lines MCF-7, SK-BR-3, MDA-MB-231 and mammary epithelial cell HBL-100, respectively.Results: 1. Real-time q PCR results: The FTO m RNA relative expressions in ER negative human breast cancer cells SK-BR-3, MDA-MB-231 were significantly higher than that in mammary epithelial cell HBL-100(p=0.049,p=0.001). While, there were not statistically different between MCF-7 and HBL-100 for FTO m RNA relative expressions(p>0.05). 2. Western blot results: FTO protein was expressed in both human breast cancer cells SK-BR-3, MDA-MB-231, MCF-7 and mammary epithelial cell HBL-100. FTO protein expressions were highest in SK-BR-3, followed by MDA-MB-231, MCF-7, and HBL-100, with significant differences among the four groups(p<0.05).Conclusion:3. Both protein and m RNA expressions of FTO in ER negative human breast cancer cells SK-BR-3, MDA-MB-231 were higher than that in mammary epithelial cell HBL-100. 4. In combination with the immunohistochemical results, we chose SK-BR-3 cell line as FTO advantage expressing cell strain, and further study of the biological function tests targeting FTO will be done.Part three: Establishing the SK-BR-3 cell line with FTO gene knocked out based on the CRISPR/Cas9 technologyObjective:To establish the SK-BR-3 cell line with FTO gene knocked out using the CRSPR/Cas9 technology, and build the platform for exploring the role of FTO in SK-BR-3 cell proliferation, migration and invasion.Methods:The g RNA recombinant plasmid was constructed according to the CRISPR/Cas9 knockout kit operation process, then transfected into SK-BR-3 cells using Lipofectamine2000 kits. We screened the transfection cells with GFP green fluorescence and puro. In the end, the sequencing method was used to identify the knock-out cells.Result:1. According to the sg RNA design principle of CRISPR/Cas9 system, we designed three shooting sites: FTO sg RNA #1, GGAACGAGAGCGCGA AGCTAAGG; FTO sg RNA #2, GCGCGAAGCTAAGGTATGTCGGG; FTO sg RNA #3, GCTAAGGTATGTCGGGCTCCCGG. 2. The results of Cas9/g RNA enzyme digestion in vitro by Agarose gel electrophoresis found that the enzyme digestion efficiency of FTO sg RNA # 3 was highest(90%), and the FTO sg RNA # 3 was chosen for follow-up study.3. The g RNA recombinant plasmid was constructed and sequenced successfully. 4. The g RNA recombinant plasmid was then transfected into SK-BR-3 cells using Lipofectamine2000 kits. We screened the transfection cells with GFP green fluorescence and puro.5. The sequencing and protein immunoblot methods identified that the FTO gene in SK-BR-3 cells was knocked out successfully.Conclusion:We successfully established SK-BR-3 cell line with FTO gene knocked out. The SK-BR-3 cell line with FTO gene knocked out was used subsequently to study the role of FTO in cell biology behavior.Part four: The effects of FTO on SK-BR-3 cell proliferation, migration and invasionObjective:To explore the role of FTO in SK-BR-3 cell proliferation, migration and invasion.Methods:The abilities of cell proliferation, migration and invasion were detected by CCK-8 kit, colony-forming assay, wound-healing and transwell invasion assay, respectively.Results:1.There were no significant differences of the ability of proliferation and the colony-forming rate in SK-BR-3 cells before and after FTO knocked out.2.The ability of migration and invasion of SK-BR-3 cells after FTO gene knocked out was declined significantly.Conclusion:Our study found that FTO deletion in SK-BR-3 cells inhibited tumor migration and invasion, which will provide a new target for breast cancer therapy. |
PDF Full Text Request