| Spinal cord injury, as the main cause of severe disability, is still a worldwide problem. Its pathology is based primarily on direct or indirect injury leading to axonal degeneration and neuronal necrosis. Adult spinal cord injury, the micro-damage to the environment results in the regeneration of central nervous difficulties. However, due to the complexity of the pathological changes of spinal cord injury, the effect of treatment has been poor. Therefore, spinal cord injury and its repair mechanism is one of the hotspots of neuroscience nowadays. To conquer this disease, many scientists committed to this area, hope to find effective way to ease the patients and family and social harm. Many laboratories have done a lot of work in the repair of spinal cord injury. According to the study of neural stem cells (neural stem cells, NSCs), stem cell therapy is expected to reach a good effect. The NSCs, it can differentiate to neurons and glial cells. After spinal cord injury, by intravenous injection of NSCs, you can find transplanted NSCs in the damaged foci, and differentiation of a certain number of neurons and glial cells. If NSCs used clinically as a cell replacement therapy, it brings big hope for the recovery paraplegic patient after spinal cord injury. The effectiveness of the transplanted NSCs, it is not ideal, the main problems is that the early graft was affected in vivo macrophage phagocytosis. If the transplantation is too late, the damage site is easy to form scar tissue and affect neuronal repair. Studies have shown that the transplantation of NSCs in the seventh day after spinal cord injury is suitable. Avoid macrophage phagocytosis, and the scar tissue does not fully form. In order to improve the effect of NSCs, how to regulate the differentiation of NSCs into more neurons is a subject worthy of study.MicroRNA as a recently discovered small RNA in post-transcriptional level of regulation of protein expression has become the focus of our attention. MicroRNAs are small RNA molecules present in the genome of plants and animals, about20-24nt (a small number of less than20nt), a hairpin loop structure consists of a section, a length of70-80nt single-stranded RNA precursors (pre-miRNA formation) after shearing. Its target mRNA molecules in the3’untranslated region (3’from a untranslated region3’UTR) is completely non-complementary match to participate in the regulation of gene transcription levels in physiological and pathological conditions and plays a very important role.miR-124as non-coding RNA was first discovered in the embryonic development of the nematodes (Caenothabditis, elegans) in1993by Lee et al. First of all, the primary transcripts of miRNA genes (the Pri-miRNAs) cutting the precursor miRNA (pre-miRNAs) by the RNase m Drosha in the nucleus. Transporter protein exPortin-5plays a role in the initial shear Pre-miRNA from the nucleus to the cytoplasm, and then further cut by another RNase in Dicer to generate mature miRNA. The mature miRNA with other proteins form RISC (RNA-induced sileneing complex) complex and they lead to the target mRNA degradation or translational repression.MicroRNAs have important tissue-specific functions and play a general regulatory role in the regulation of gene expression. miR-124is a specific expression of the nervous system, and most rich in microRNA. miR-124restrictively expresses in the CNS in the chick embryo ganglion. In mice, the miR-124concentration in the nervous system (cortex, cerebellum and spinal cord) is more than100times that of other organs. However, miR-124expression on the anatomic region of the central nervous system, there are obvious differences in the cerebral cortex. A maximum rate of60.7%in the cerebral cortex, cerebellum, and the spinal cord is35.4%. miR-124expresses in the process of cell proliferation and differentiation, its cellular localization is expressed in the development and maturation of the nervous system neurons. miR-124plays an important role in the regulation of pathological changes of the nervous system. It is reported in the literature, miR-124regulation in tumor tissue is not yet deeply studied, it is only found in the neural tube neural tube cell tumor and pleomorphic malignant glial cell tumor in the regulation of tumor growth. miR-124regulates neuronal cell cycle, cell differentiation, and development of the spinal cord of a series of important physiological activities. As a nervous system-specific microRNA, the regulatory mechanism of pathological damage of the nervous system is not yet clear, especially in the regulation of spinal cord injury it is not reported in the literature. This subject will take advantage of miR-124regulation of NSCs treatment of spinal cord injury.Part I miR-124promotes differentiation of BMSCs-D-NSCsObjective:To use viral transfection technology, miR-124was used to transfect MSCs, and which were induced into NSCs. We observed miR-124role of NSCs in vitro and establish a basis for the further treatment of spinal cord injury.Methods:miR-124sequence5’-UAAGGCACGCGGUGAAUGCC-3’was found in gene bank. The PCR primers were designed:the former primer5’-GCCGATTC (of EcoRI) CATCGCGTTCCCCAAACCCC-3’and antisense strand primer 5’-GCCGGATCC (the BamHI) AGGGATGAAGGTGCTGGCCT, amplified out of miR-124. The synthetic lentiviral the carrier pCDH-CMV-MCS-EF1-copGFP EcoRI/the BamHI digested, and then PCR amplified microRNAs Rno-miR-124, and in the upstream and downstream primers were added to the restriction point EcoRI and BamHI, finally, connect the above two partially digested and transformed into DH5-a. Picked positive clones were identified by PCR and sequencing. The plasmid was used to infect the293T cells. Supernatant was used to infected the MSCs, RT-PCR was performed to detected the expression of miR-124after transfected MSCs which were induced into NSCs. Finally we observed the differentiation of NSCs to into neurons and glial cells.Statistical analysisAll data are shown in mean±SD, the Student t-test to compare the infected group and uninfected group, the differentiation of NSCs, Statistical software using SPSS17.0, P<0.05was considered statistically significant.Results:The transfection rate of miR-124reached up to90%. RT-PCR results showed that after transfection of MSCs of miR-124expression is30-fold prior to transfection. After induced into NSCs, in the transfected group, The proportion of NeuN positive cells was53.60%±3.31%, the proportion of non-transfected group was34.40%±2.88%(p<0.001). In the transfected group, GFAP-positive cells was42.20%±1.62%, and51.90%±3.03%in the non-transfected group (p<0.001). Conclusion:miR-124can promote NSCs to differentiate into neurons in vitro.Part II the role of miR-124-NSC in spinal cord injuryObjective:To administor miR-124NSCs by tail vein injection to treat spinal cord injury and observe the therapeutic effect of miR-124-NSCs in Wistar rats.Methods:According to the modified Allen’s method to make animal models,90adult Wistar rats were taken to Ketamine Hydrochoride (50mg/kg, i.p.) by intraperitoneal injection of anesthesia, fixed prone to T10as the center longitudinal incision to expose the strike zone of the spinal cord. The size was3.0cm x0.4cm. An iron head weighted20g, and3mm in diameter falling from10cm high to strike the exposed spinal cord and the potential was200g.cm. When we observed the rat hind limbs twitched, flicked, and then fully relaxed, the SCI model was regarded as successful. SCI models were divided into three groups; the first group was untreated control group, injected with saline; the second group was normal transplantation group, injected with NSCs, and the third group was transfected group, injected with miR-124-BMSCs-D-NSCs. Take specimens of the three groups in the1day,1week,2weeks and4weeks after spinal cord injury. By HE staining, the cavity volume of transfected group and miR-124free NSCs group was compared with control group. The function recovery of rat spinal cord was assessed by BBB scores.Statistical analysisData were statistically analyzed and presented as Mean±SD. Independent samples t-test was used to assess the damaged cavity volume reduction ratios of the modeled SCI rats in Group2(NSCs graft) and Group3(miR-124-NSCs graft), comparing with Group1(sham control), and also used to evaluate the ratios of differentiation of NSCs and miR-124-NSCs in vivo and in vitro. Differences of BBB scores among the groups were assessed by ANOVA with LSD test. All statistical analyses were two-sided and performed using statistical software (SPSS version17.0; SPSS Inc, Chicago, IL). Differences were considered statistically significant at p<0.05.Results:Identification of donor cells in vivoImmunohistochemical analysis was performed to identify miR-124-NSCs in the lesions. NSCs and miR-124-NSCs that had been intravenously administered were identified14days after transplantation. We found that the miR-124-NSCs labeled with GFP were primarily in and around the damaged sites in the spinal cord (Figure4A). In addition, confocal images showed more neural markers NeuN (Figure4B) and fewer astrocytic markers GFAP (Figure4C) appeared at the14th day after transplantation. The survival ratio of NeuN-positive cells derived from miR-124-NSCs accounted for16.4%±2.1%. The survival ratio of GFAP-positive cells differentiated from miR-124-NSCs was13.5%±4.9%.The assessment of cavity volumeSpinal cords in all groups were stained with HE after SCI (Figure5)(n=30) and sample sections were obtained from the middle of the lesion at the1st,7th,14th and28th day after SCI (Figure5A-D). Necrotic cavity volume in the Group3(miR-124-NSCs graft) was significantly smaller than those in the Group3(NSCs graft) compared with Group1(sham control, saline alone) at the28th day after SCI (p <0.001). The mean reduction ration of cavity volume was3.3%and6.4%in NSCs graft group and miR-124-NSCs graft group, respectively (Figure5E)(p<0.001). The mean reduction of cavity volume was3.3%and6.4%in NSCs group and miR-124-NSCs group, respectively.BBB scoresAll animals had near complete hind limb paraplegia immediately after SCI, and gradually recovered in varying degrees of motor performance over the time course of6weeks (n=90). The first week, the BBB score between the three groups no significant statistical difference (P=0.804). The second week, NSCs transplantation group and control group, the BBB score of NSCs group statistically significant differences (P=0.017), the control group and miR-124transfection group, the BBB score was a significantdifference (P=0.035) and miR-124transfected group had no statistically significant difference (P=0.698). The third week of NSCs transplantation group and normal control group, there was a statistically significant difference (P=0.006), miR-124transfected group and the normal control group, there was a statistically significant difference (P=0.001). For NSCs group and miR-124group there was no statistically significant difference (P=0.290). The fourth week, NSCs transplantation group and normal control group, there was a statistically significant difference (P=0.007), for miR-124transfected group and NSCs transplantation group, there was a statistically significant difference (P=0.002), miR-124transfected group and the normal control group had statistically significant difference (P<0.001). In the fifth week, the pairwise comparisons among the three groups had statistically significant difference (P<0.001). In the sixth week, the pairwise comparisonsamong the three groups had a statistically significant difference (P<0.001).Conclusion:miR-124in the NSCs treatment of spinal cord injury can play a better role. |
PDF Full Text Request