Dihydro-biopterin Reductase Down TGFβ1 / Experimental Study Of Diabetic Nephropathy Development Smad3 Signaling Pathway Involved

Backgroud:Diabetic nephropathy (DN) has surpassed other major diseases to become the most common cause of the end-stage renal disease. The major cause of DN is the disorder of microcirculation in the glomerular, which eventually develops into glomerulosclerosis. Although the mechanisms of glomerulosclerosis are still under investigation, cytokines such as transforming growth factor beta1(TGF-β1) appear to play animportant role in pathogenesis of DN. TGF-β1is considered as a key mediator in diabetic nephropathy by inducing glomerulosclerosis and fibrosis. In our previous study, we have reported that there was the modification of QDPR gene in renal cortex of spontaneous OLETF diabetic rats, which suggests a role of QDPR in diabetic nephropathy. Dihydropteridine reductase (QDPR) plays an important role in the metabolism of biopterin, especially in the recycling of tetrahydrobiopterin (BH4), which is an essential cofactor of nitric oxide synthase (NOS). NOS can catalyze the conversion of arginine to citrulline releasing nitric oxide (NO). Increased NO production in the kidney generated from eNOS/nNOS has been documented to be involved in development of diabetic hyperfiltration. Moreover, decreased NO production will lead to an increase in TGF-β1expression, in the current study, we investigated the role of QDPR on TGF-β1/Smad pathway in diabetic rats and293T kidney cells.Objective:To observe the expression of QDPR in diabetic nephropathy rats and the regulation of QDPR in TGF-β1/Smad pathway.Methods:1. The expression of QDPR in type1diabetic nephropathy ratsDiabetic nephropathy model was induced by a single intraperitoneal injection of STZ at a dose of40mg·kg-1diluted in citrate buffer. Seventy-two hours after STZ injection, rats for blood glucose over16.7mmol·L-1were confirmed to be in diabetic state. After20weeks, renal cortex was isolated immediately and stored for the following study. RT-PCR and Western blot were adopted to observe the expression of QDPR, TGF-β1, Smad3and NOXs.2. The effect of wide type QDPR on regulating TGF-β1/Smad pathwayFirstly, we constructed a recombinant plasmid to observe the effect of wide type QDPR on regulating TGF-β1/Smad pathway. We amplified PCR fragments with QDPR specific primers (forward primer with EcoRV enzyme site AGATATCATGGCGGCTTCGGGCGAGGC; reverse primer with XbaI enzyme site ATCTAGAGAAATAGGCTGGAGTAAGCT) using the cDNA of rat renal cortex as a template and rat QDPR cDNA fragment was confirmed by sequence analysis. Then, rat QDPR cDNA was subcloned into pcDNA3.1/V5-His-A vector to form recombinant plasmid DNA rQDPR/pcDNA3.1/V5-His-A (rQDPR). Vector pcDNA3.1/V5-His-A (no cDNA) was used as the control vector group and the recombinant cDNA rQDPR (rQDPR group) was transfected into the293T cells. All sets of transfections were performed at least in triplicate. Cells were collected at72h for RT-PCR and Western blots analysis. RT-PCR and Western blot were adopted to observe the expression of QDPR, TGF-β1, Smad3, nNOS and NOXs. BH4levels were determined using an ELISA assay.The knockout experiment was adopted to identify the regulation of QDPR on TGF-β1/Smad pathway. Co-Transfection of rQDPR/pcDNA3.1/V5-His-A DNA and Rat QDPR Small Interfering RNA. The target sequences of rat QDPR siRNA (GCCAGCGUGAUUGUUAAGATT, UCUUAACAAUCACGCUGGCTT) was designed. The cells were divided into three groups:rQDPR group, rQDPR+siRNA group, and rQDPR+control siRNA group. Two days following transfection, cells in the6-well plates were harvested for immunoblotting to determine the degree of rat QDPR protein knockdown. Then, TGF-β1was determined by ELISA kit from culture media.3. The study of QDPR with mutation on regulating TGF-β1/Smad pathwayFirstly, we constructed a a recombinant plasmid to observe the effect of QDPR with mutation on regulating TGF-β1/Smad pathway. QDPR cDNA was amplified with specific primers using the cDNA from renal cortex of OLETF diabetic rat as a template. Rat QDPR cDNA fragments was then subcloned into pcDNA3.1/V5-His-A vector to form recombinant plasmids DNA of rQDPRmut/pcDNA3.1/V5-His-A (rQDPRmut). Control vector, recombinant rQDPR plasmid and rQDPRmut plasmid were transfected into the293T cells. Cells were collected at72h for mRNA and protein analyses. TGF-β1was determined by ELISA kit from culture media. Smad3and BH4levels was analysed by Western blot and ELISA assay, respectively.In addition, the effect of QDPR on autophagy was observed as well. HEK293T cells were transiently transfected with recombinant plasmid DNA rQDPR and recombinant plasmid DNA rQDPR (mut) by calcium phosphate. After72h, the expression of rat QDPR in293T cells was detected by Western Blot. Then, the effects of QDPR on autophagy related gene (including LC3and Beclinl) were analyzed by RT-PCR, and Western blot was used to monitor the changes in autophagy associated protein level.Results:1. Significantly decreased expression of QDPR was observed in STZ-induced diabetic rat kidneys at20weeks after STZ injection (p<0.05). At the same time, there were significantly increased expression of TGF-β1, Smad3, NOX1and NOX4in the renal cortex of diabetic group (p<0.01), however, there was no difference in NOX2and NOX3mRNA abundance between control and diabetic groups.2. After transfection of rQDPR in293T cells, there was a significant elevation of QDPR protein in293T cells. Moreover, with increase in QDPR expression, there were decreased expression of TGF-β1and Smad3at both mRNA and protein levels. BH4level in the rQDPR group was significantly higher than that of the control vector group, indicating that BH4production was upregulated in response to the QDPR overexpression. Since BH4is an important cofactor of NOS and there was an elevation of BH4level after QDPR overexpression, we further examined the mRNA level of NOS in293T cells. After transfection, QDPR appeared to induce expression of nNOS (p<0.05) in293T cells. Both the mRNA levels and the protein expression of NOX1and NOX4were significantly decreased in the rQDPR transfected cells as compared to that of control vector transfected cells (p<0.05)Co-transfection with rQDPR/pcDNA3.1/V5-His-A DNA and rat QDPR siRNA reduced rat QDPR protein levels by more than80%. The result showed that the expression of TGF-β1and NOX4in rQDPR+siRNA group increased compared to rQDPR group.3. After transfection of rQDPR(wt) and rQDPR(mut), there was a significant elevation of QDPR protein in293T cells. Moreover, with increase in QDPR expression, there were decreased expression of TGF-β1and Smad3at both mRNA and protein levels. the expression of NOX4was significantly decreased in the rQDPR(wt) transfected cells as compared to that of control vector group (p<0.05) while NOX4was increased in rQDPR(mut) group compared to control vector group (p<0.05).Besides, we discovered that QDPR had effect on autophagy, and the results show that the recombinant plasmid DNA rQDPR and recombinant plasmid DNA rQDPR (mut) were successfully constructed. The fusion protein can also express in HEK293T cell. In addition, compared with control vector group, the mRNA expression of LC3was significantly up-regulated in rQDPR group (P<0.05), and the mRNA expression of Beclinl showed no significant difference among the3groups (P>0.05). The Western blot analysis revealed that LC3II and Beclinl increased in rQDPR group when compared with control group, and there were no difference of LC3I protein levels among the3groups.Conclusions:1. The expression of QDPR was injured in diabetic nephropathy rats. The decrease in QDPR and the increase in TGF-β1and Smad3expression in diabetic rats suggest a link between QDPR and TGF-β1signaling pathway.2. The current study reveals a correlation between QDPR and NOXs/TGF-β1signaling pathway in the kidney of diabetic nephropathy. Moreover, that transfection of QDPR directly reduced the gene expression of TGF-β1/Smad3and NOX1/NOX4in293T cells indicates a function of QDPR in the kidney, which may be useful for development of a new therapeutic strategy for patients with diabetic nephropathy.3. Together with the previous observation that transfection of QDPR directly reduced the expression of TGF-β1/Smad3, we observed the levels of TGF-β1and Smad3increased when there was a point mutation, indicating that this mutation played a crucial role in regulating TGF-β1/Smad3signaling pathway. Whether this mutation is linked with the structure of QDPR may be undertaken as a next step using protein structural modeling. Additionally, QDPR may activate the autophagy of HEK293T cells by increasing the expression of autophagy associated genes of HEK293T cells.