The Regulatory Mechanisms Of Phenazine-1-carboxylic Biosynthesis In The Rhizobacterium Pseudomonas Aeruginosa PA1201

Phenazine-1-carboxylic acid(PCA)is one of the secondary metabolites of most Pseudomonas strains.Phenazines are best known for their antibiotic properties,and affect a broad spectrum of organisms including bacteria,fungi,plants,nematodes,parasites,and humans.PCA was commercially named as Shenqinmycin.1 % Shenqinmycin suspension was registered in China as an environmentally friendly fungicide(Product no.PD20110315).It is being marketed in China to control rice and vegetable diseases caused by Rhizoctonia solani and Fusarium oxysporum.However,due to the low industrial fermentation titre of PCA,the production costs of the biopesticide(1 % Shenqinmycin suspension)are much higher than other chemical pesticides,limiting the feasibility of its application.In this study,the regulatory mechanisms of PCA biosynthesis were investigated,these findings can provide a basis for further improvement of PCA production.Pseudomonas aeruginosa strain PA1201 was originally isolated from the rice rhizosphere and displayed strongly inhibitory activity toward the pathogens R.solani and Xanthomonas oryzae pv.oryzae.PA1201 was shown to have more biotechnological potential for industrial production of PCA.PA1201 contains two PCA biosynthetic gene clusters phz1/phz2 and a complete set of genes for four QS systems(LasR/LasI,RhlR/RhlI,MvfR/PqsABCDE and IQS).By using several methods including gene deletion,the construction of promoter-lacZ fusion reporter strains,and RNA-Seq analysis,this study investigated the effects of the four QS systems on bacterial growth,QS signal production,the expression of phz1 and phz2,and PCA production.Individual deletion of these genes or gene clusters has slight effect on bacterial growth in PPM medium.Both phz clusters contribute to PCA production,with phz2 making a greater contribution.The regulation of LasR/LasI on PCA biosynthesis is growth phasedependent,and the newly identified IQS system shows no effect on both phz expression and PCA production.Both RhlR/RhlI and MvfR/PqsABCDE are essential to the phz expression and PCA biosynthesis.The possible mechanisms for the strain-and condition-dependent expression of phz1 and phz2 were discussed,and a schematic model was proposed.RsaL is a transcriptional regulator belonging to a new subfamily within the tetrahelical superclass of helix-turn-helix proteins.RsaL represses the expression of lasI and the accumulation of N-3-oxododecanoyl-homoserine lactone(3-oxo-C12-HSL)in P.aeruginosa PAO1.The general objective of this study is to investigate the effect of RsaL on the expression of phz gene clusters,PCA biosynthesis,the QS signal production and the expression of QS signal synthase genes in P.aeruginosa PA1201.We found that RsaL negatively regulates the PCA production.RsaL represses the expression of phz1 and the phz1-dependent PCA production,meanwhile RsaL positively regulates phz2 expression and phz2-dependent PCA production.EMSA and DNaseI protection footprinting assay showed that RsaL specifically binds to 25 bp DNA region(TTTTATGCAATCCACATCAGCGACC)in the phz1 promoter.The direct binding of RsaL on the phz1 promoter represses its expression and PCA biosynthesis.Our study showed RsaL has no direct binding in the phz2 promoter.RsaL was further shown to indirectly regulate PCA biosynthesis through QS signaling network.RsaL negatively regulates lasI expression and 3-oxo-C12-HSL biosynthesis.RsaL positively regulates rhlI expression and N-butyryl-homoserine lactone(C4-HSL)biosynthesis.We confirmed RsaL represses the production of 2-heptyl-4-quinolone(HHQ)and 2-heptyl-3-hydroxy-4-quinolone(PQS).Over all,our results contributed a better understanding of the regulatory mechanisms of RsaL in PCA biosynthesis.OxyR is a typical LysR-family transcriptional regulator.OxyR plays a key role in the upregulation of defense mechanisms against oxidative stress as it stimulates the expression of the antioxidant genes.The purpose of this study is to investigate the role of OxyR in PCA biosynthesis.By using several methods including the construction of promoter-lacZ fusion reporter strains,analysis of QS signal molecules production,EMSA and RNA-Seq,we demonstrated that both deletion and overexpression of oxyR significantly increasedproduce PCA biosynthesis in PA1201.Deletion of oxyR only leads to an increase in phz2 expression.However,overexpression of oxyR significantly increased phz1 expression.Further analysis indicated that the positive effect exerted by OxyR overexpression on phz1 expression is mediated by the small RNA PhrS.OxyR positively regulates the expression level of PhrS.EMSA showed that OxyR has no direct binding in the phrS promoter.PhrS has been previously identified as an activator of MvfR synthesis.We showed that OxyR positively regulates HHQ and PQS biosynthesis.As a consequence,the production of PCA is increased in oxyRoverexpression strain.A schematic model for the regulation of OxyR on PCA biosynthesis was proposed.Over all,our results contribute to a better understanding of the regulatory mechanisms of PCA biosynthesis by QS systems,RsaL,and OxyR.These findings provide a basis for further genetic engineering to improve PCA industrial production in PA1201.