The Role And Significance Of Long Noncoding RNA CAT1257 In Triple Negative Breast Cancer

BackgroundBreast cancer is not only the most common malignant tumor in the world,but also at the second mortality in femaletumor.In recent years,breast cancer has become the the most common malignant tumor inChinese women,according to statistics,China’s womens cases accounted for 12.2%of new cases and 9.6%of mortality rate in the world.Thetreatmentsofbreast cancer arediverse,including surgery,chemotherapy,radiotherapy,endocrine therapy and trastuzumab-based targeted therapy which is springing up in recent decades.However,although the comprehensive therapies of breast cancer can significantly decrease the recurrence rate and mortality and prolongs disease-free survival(DFS)and overall survival time(OS)of patients,but the prognosis of some special types of breast cancer are not ideal.Breast cancer is a highly heterogeneous diseaseat the molecular level.Breast cancer hassimilar organization form and tumor pathological classification,but its molecular genetic change may be different totally,resulting in different tumor treatment and prognosis.Precision medical era is coming,breast cancer molecular classification to study the heterogeneity of tumor has laid a theoretical foundation and it has become a important basis of clinical diagnosis and treatment.The molecular classification of breast cancer mainly include four types:luminal A type,luminal B type,HER-2 expression type and basal-like type.Basal-like breast cancer(BLBC)belong to the Triple negative breast cancer(TNBC),but BLBC express basal type of keratin.The prognosis ofHER-2 expression and basal-like breast cancer is poor,it may due to a lack of Estrogen receptor(ER),Progestrone receptor(PR)andHER-2 targets in the triple negative breast cancer.So itcannot respond to endocrine therapy and targeted therapy,except for chemotherapy alone.Poor curative effect,high transfer rate,short disease-free survival(DFS)and overall survival(OS)makethe treatment of 1NBC a difficult and hot problem.Because of this subtype of breast cancer,it has immanent genotyping,unique recurrence and transfer mode.Itseffictive treatment is unclear and there is unknown treatment targets.However,not all three negative breast cancer is sensitive to chemotherapy.When the patients suffered the cancer cells are not sensitive to chemotherapy or easily resistant to chemotherapy are prone to local recurrence,distant metastasis and other adverse events which will affect survival time.With the rapid development of tumor genomics and proteomics,the research of breast cancer is becoming more and more deeply.The tumor is a disease of genetic heterogeneity.Some damage or stimuli cause oncogene activation or tumor suppressor gene inactivation,resulting in abnormal cell proliferation,differentiation,apoptosis and tumor formation.In 2000,Perou began to study the gene expression of breast cancer,8102 human genesof 65 breast cancer patientswere made out to cDNA microarray assay.They found the same tumor gene expression is relatively stable,and there is a big difference between different tumor gene expression.Then he first put forward the four subtypes of breast cancer.Molecular classification becomes more mature and more clinical,which provide the basis for individualized treatment of breast cancer.In the process of the transcription of eukaryotic genomes,a lot of long chain non-coding RNA was generated,keeping the complexity ofthe expression of the genome and regulating.Although the understanding of the long chain noncoding RNA is not enough,they was usually considered as "noise" in the gene transcription.Long chain noncoding RNA(incRNA)is generated by genome noncoding sequence of transcription,whichlength is more than 200 nt and can notbe translated into protein transcription.In recent years,a large number of experiments proved that the "noise" in the part of the genome noncoding RNA transcription by long chain in epigenetic level,transcription,translation,protein modification process,itwould play an important regulatory role.However,in recent years,functional incRNAs had been found gradually that incRNAscome into the peopled line of sight.For example XIST is closely related to inactivation process of X chromosome;PRNCR1 and PCGEM1 are closely related to prostate cancer;Braveheart play an important role in the development process of cardiovascular and Lnc-DC is associated with dendritic cells differentiation,and so on.In the field of oncology,IncRNA became another hot research topic sincemicroRNA.In breast cancer,LncRNA can regulate the biological behavior of tumor cellsthrough various mechanisms.In some studies it have been found that IncRNA-HOTAIR play an important role in the process of breast cancer metastasis,HOTAIR is in high expression of primary breast tumor and metastastic tumors,even much higher in metastastic tumors.There is positive correlationbetween themetastasis andthe level of expression of HOTAIR.HOTAIR promoted tumor metastasis through PRC2 protein mediated epigenetic changes.Decreasing the expression of HOTAIR can inhibit tumor invasion and metastasis.LncRNA-FAL1 increased in gene copy number indicates poor prognosis in breast cancer,lncRNA-FAL1 combined withCDKNIApromoter toregulate the transcription of CDKNIA by adjusting BMI1.FAL1 plays to promote tumor formation,proliferation and inhibiting aging,etcthrough inhibition of P21.LncRNA-BCAR4 was found high expression in TNBC,and BCAR4 can interact with SNIP1 and PNUTS which are its combining protein,promote cancer cells migration by activating the Hedgehog/GLI2 signal pathway.Thespecific regulating machanism of LncRNA,in general,mainly divides into the mechanism of transcription regulation(including cis and trans regulation)and regulation of translation level shear regulation and other transcription regulations.LincRNA-RoR isalso high expression in triple negative primary and metastatic breast cancer,itcan regulatelnvasion and metastasis of miR-145.Based on the fact that incRNA plays an important role in the process of in the tumorgenesis anddevelopment,but few functional lncRNA were reported in the field of breast cancer,especially TNBC.As a cornerstone for regulating TNBC,we would seek the mechanism of recurrence or metastasis of TNBC and explore related therapeutic targets,finally these studies are expected to provide the evidence that lncRNA could be used as the target forclinical therapy of TNBC patients.Therefore,in this research wedetectedthe expression of lncRNA of triple negative breast cancer tissue and tissue adjacent to tumorby means of tissue microarray,and screenedlncRNAs which are related to TNBC prognosis and may play an important role in tumorigenesis and tumor metastasis,We will carry outdeeperresearch to reveal lncRNAs comprehensive,systematic and deeply how toinfluencethe development of TNBC and provide new molecular targets for the diagnosis and treatment of triple negative breast cancer.First of all,165postoperativespecimens of TNBC patients who were confirmed by pathology and matching the 33 specimens of tissue adjacent were studied.To make them into a transcriptional chip and examine the expression oflncRNA and Messenger RNA(mRNA).After standardized data processing,we found that the expression of Lnc RNA is significant differentbetween cancer tissue and cancer adjacent tissuethrough the comparison,we picked out 183 mRNAs,195 lncRNAs,which showed relationship with tumor specificity and relapse-free survival(RFS).SrceenlncRNAs by bioinformatics analysis.From mitransciptome(2015,NG)transcript database lncRNAs were selectewith following conditions::associated with breast cancer","the length<2000 bp" and so on,finally 26 incRNAs.Then using quantitative PCR for more lncRNAs verification,so as to find correct were found.As one of theseincRNAs,lncRNA CAT1257 showed high expression in TNBC cell lines,we can conclude the lncRNA is closely related to the development and prognosis of TNBC,andthis need to be certainedby further study.Some studies have shown that lncRNA can be used as molecular markers to predict the prognosis of patients with cancer.Because ofhncRNA CAT1257 has not been publicly reported before,function and characteristic of the lncRNA are not clear enough.Whether lncRNA CAT1257 is the molecular markers of TNBC in future,predict responce to chemotherapy,and become the new targets for TNBCor not should to be further studied.2 MethodsPart I:The detection and analysisof lncRNAsininmicroarray of TNBC tissue and adjacent tissues.Thel65 tissue microarray speciman are from the TNBCpatients in Shanghai Fudan University Cancer Centrefrom 2011-01-01 to 2012-12-31.The staffs in pathology department determine the status of ER,PR,HER-2 byimmunohistochemistry(immunohistochemistry,IHC)method.ER,PR negative is defined as:In the case of a positive case of intermal control,<1%of the nuclei of tumor cells staining.HER-2 negative is defined as:(-),(+),if(++)then checking by FISH(Fluorescence in situ hybridization,FISH)detection,FISH shows no amplification.27-83 age distribution,with a median age of 55 years.All patients enrolled were signed informed consent to collect tissue samples,and the collection and use of patient organizations have received ethics committee approval.5 cm relative to normal tissue outside the adjacent tissues were taken from the edge of the tumor and by pathological examination confirmed no tumor.Transcript chip is composed of 198 samples,including 165 TNBC tissues and 33 pairs of adjacent tissues.US companies with Affymetrix human transcripts(HTA2.0)gene chips(Affymetrix,Santa Clara,CA,USA).According to Asymetrix’s standard operating procedures,using biotinylated cDNA hybridization HTA2.0 chip.After hybridization and washing,with Affymetrix(?)GeneChip Command Console(AGCC)GeneChip(?)Scanner 3000 7G software to scan the chip.Chip fabrication and its data analysis by the Shanghai Information Technology Co.,Ltd.Ming(Gminix)is completed.After the messenger RNAs and lncRNAs screening:We chose the differentially expressed mRNA(fold change>2 or<0.33 and the false discovery rate(false discovery rate,FDR)<0.001).Threshold lncRNAs differentially expressed as follows:fold change>1.5 and FDR<0.001.By combining RNA expression microarray data and 165 TNBC patient follow-up data,we obtained a set of RNAs that relapse-free survival(RFS)related.mRNA selection:P value less than 0.1(log rank test)was considered significant difference duplieate mRNA were excluded.lncRNAs selection:P values less than 0.2(log rank test)was considered significantly different,compared with the mRNA,the correlation is not significant In addition,only between genes lncRNAs was selected account.We chose overlapping mRNAs and lncRNAs,183 were screened difference mRNA,195 differentially lncRNA,and these tumor-specific RNAs that RFS are related.We will pick a good LncRNA bioinformatic analysis.Frommitransciptome(2015,NG)websitehttp://www,mitranscriptome.org.Pick out the lncRNAs that were relevant to breast cancer,and the length<2000bp.After screening,26 lncRNAs were found.Part Ⅱ:Long non-coding RNA test CAT1257 features and functions:l)screening candidate lncRNAs:We use Real-Time PCR validation to find out next a total of three lncRNAsare consistent with the original chip results;2)lncRNA-CATl257.1/CAT1257.1 in breast cancer cells expression was detectedby quantitative PCR,of which only 1257 specifically expressed lncRNA CAT in TNBC;3)construction of RNA interference pLKO.1 vector 4)lentiviral packaging:subculture grew well in 293FT cells after co-culture 18-24hr transfection,virus-containing culture supernatants were collected after 48hrs;5)pLVTHM building inducible lentiviral vectors;6)construction ofpLenti6.2-tTR-KRAB vector;7)construction of the pLVTHM-mCherry-shRNA IncRNA CAT1257 stable cell line induced;construction of cell lines;8)construction of PCDH-lncRNA CAT1257 overexpression;9)CCK8 experiment to explore the influence of IncRNA CAT1257to TNBC cell line proliferation.The Ⅲ part:the study of mechanism of lncRNACAT1257 and protein interactions:1)RNA extracted for RACE experiment using;2)RNA add PolyA tail;3)RACE get template(1st cDNA synthesis)4)RACE desired length primer design;5)RACE amplification for IncRNA full length;.6)TA cloning and identification of the product is recovered connection T vector;7)lncRNA CAT1257 determine the full length cloning;8)Triple SILAC cultured MDA-MB-231 cell line;9)DNA.plasmid linearization;10)Tris saturated phenol extraction linear DNA plasmid;11)T7 transcription in vitro(NEB:HiScribeTM T7 High Yield RNA Synthesis Kit);12)RNA preliminary purification phenol-chloroform extraction and Ethanol Precipitation(removal and proteomics enzyme component);13)RNA was further purified(removal of small RNA and DNA);14)RNA concentration process(convenient RNA labeling);15)RNA-Biotin labeled(PierceTM RNA 3 ’End Biotinylation Kit);16)RNA.refolding;.17)Biotin-RNA binding and Beads;18)cell protein sample lysis(whole protein extration);19)protein samples RNP closed;20)RNA-pROTEIN binding experiments;21)RIP(RNA immunoprecipitation)3.ResultsWe selected pathologically confirmed triple negative breast cancer samples including 165 cancer samples and 33 cases cancer tissues and para-carcinoma tissues.The expression levels of non-coding RNA and messenger RNA(Messenger RNA,mRNA)were detected by HTA 2.0 chip.Cancer-specific expressing and recurrence-free survival(RFS)related RNA including 183 mRNA and 195 differentially lncRNA were screened out.26 IncRNAs that were shorter than 2000bp and existed both in the Mitransciptome database and the lncRNAs we screeded out.Next,we investigated the role of CAT1257.1 in regulating breast cancer cell growing and metastasis.l)lncRNA CAT1257.1 in triple negative breast cancer is highly expressed:according to RNA-seq data(Fig.1),CAT1257.1 is highly expressed in breast cancerr comparing in normal tissues.Meanwhile,same situation was also observed in other cancer types indicating CAT1257 may be overexpressed in a broad spectrum of cancer types.We designed three pairs of primers of lncRNA CAT 1257(No.TN9B)and Quantitative PCR found there was only one transcription product existed,namely CAT1257.1.Further experiments found CAT1257.1 were overexpressed in TNBC cell lines and low expressed in normal cell lines and non-TNBC breast cancer cell lines.This indicated that CAT1257.1 may be a TNBC specific lncRNA.2)Knockdown lncRNA CAT1257 strongly inhibited cell proliferation.We builded pLKO.1-shRNA lncRNA CAT1257,packed into lentivirus and infected MDA-MB-231,cell proliferation was significantely reduced.The specific mechanism needs further study.In addition,we explored the mechanism of lncRNA CAT1257 in regulating breast cancer improvement.1)The obtain of the full length of lncRNA CAT1257.RNA were extracted from MDA-MB-231 and MCF10A cells.SMARTer RACE cDNA amplification were used to get 5’RACE and 3’RACE product.To get the target sequence,we designed two pairs of primers for 3’RACE and 5’RACE,only the first pair of primers can get the 3’RACE product,and the product band in gel electrophoresis is relatively simple.Cloning and sequencing valadited the sequence.5’RACE amplified products are more complex,two sets of primers obtained two products.5’RACE product was subjected to sequence alignment.The sequence of the longer 5’RACE fragment product including that of the shorter 5’RACE fragment product,while the content of the short segments product is relatively so weak.So we chose the longer 5’RACE fragment product for the following experiments.According to the longer 5’RACE fragment product and the 3’RACE product,we gotthe theoretical full-length(Fig.3).The theoretical full-length sequence was 1730bp long,and we designed one pair of primers capable to amplify the whole length by PCR(F:ATTACCTGTGATTTCAAGTGGG,R:CAGCTACAATAAATGTCAAGTCCTT).Touch Down PCR was used to amplify the full-length of CAT1257.1 by using the primer pairs in the 5’RACE cDNA template.Agarose gel electrophoresis for the amplification products were showed in FIG.3),and sequeneing valadited the results.The sequence of the full length product is:>FULL LENGTH by Amplification from cDNA library(1730bp)2)RNA PULL DOWN combining SILAC to identifie the interacting proteins of incRNA CAT1257.SILAC means stable isotope labeling with amino acids in cell culture.Cell culture medium containing light,medium and heavy isotopes labled essential amino acids(in this experiment was Lys and Arg protein tag)were used to culture MDA-MB-231 cell lines.After 5-7 generations,all the proteins will be labled by isotope.After processing different experimental purposes,equal mixture of various types of protein,and then analyzed by SDS-PAGE separation and mass spectrometry.By comparing the size of the isotope peak area in the primary mass spectrogram,we can get relative quantitation.And then by sequencing the peptide fragment using the secondary mass spectrogram,we can focous on the potential proteins.In this study,we got five candidate proteins for subsequent RIP authentication.We chose these five proteins because there were existing IP level antibodies for use.RNA immunoprecipitation samples were validated by semi-quantitative PCR and foxund CAPRIN1 were related with lncRNA CAT1257.CAPRIN1 was known to be overexpressed in more than 70%of breast cancers,and was closely related to the proliferation of tunor.The specific relationship between protein CAPRIN1 and lncRNA CAT1257 are still unknown.4.Discussion and conclusionsVery few researches have reported IncRNAs in triple-negative breast cancer.We combinated the data of the triple-negative breast tissue microarray and the transcript database "mitransciptome" to screen triple negative breast cancer related lncRNA.In the current study,we compaired the expression of non-coding RNA and messenger RNA in triple-negative breast cancer tissue and in the paired nomal-appearing tissues.Cancer-specific expressing and RFS related RNA including 183 mRNA and 195 differentially lncRNA were screened out.In order to find breast cancer-related lncRNA more accurately,we used keywords "intergenic(Intergenic)" "lncRNA""mammary(breast)" "tumors(cancer)" to further screen,and finally found 26 lncRNA.According to RNA-seq data,CAT1257.1 is higher expressed in breast cancer tissues than in adjacent cancer tissues and nomal tissues.Similar situations were found in other cancer types.So the CAT 1257 may be a broad spectrum of cancer-related lncRNA.Quantitative PCR revealed there was only one specific transcription product,namely CAT1257.1,but not CAT1257.2.Further experiments found CAT1257.1 were overexpressed in TNBC cell lines and low expressed in normal cell lines and non-TNBC breast cancer cell lines.This indicated that CAT1257.1 may be a TNBC specific lncRNA.We builded pLKO.1-shRNA lncRNA CAT1257,packed into lentivirus and infected MDA-MB-231,cell proliferation was significantely reduced.The specific mechanism needs further study.RNA PULL DOWN is the most commonly used technique for investigating the interaction between RNA and protein.The most commonly operation steps are randomly incorporate Biotin-UTP during RNA in vitro transcription,thereby obtain a sample with Biotin labeled RNA which can be used directly for RNA PULL DOWN experiment.However,the full-length product in the presence of random Biotin may affect the higher-order structure of RNA.Therefore,we abandoned the randomly labeled RNA sequences technique,and used the RNA 3 ’end-labeling technique by using T4 RNA ligase connects Biotin labeled cytidine diphosphate to the single-stranded RNA 3 ’end.3 ’terminal end of the RNA marker does not interfere with the structure,therefore,is more desirable than the incorporation of labeled nucleotide random.Although RNA 3 ’end-labeling technique can avoide many false positive binding proteins,but directly eluted samples by SDS-PAGE can easily get a lot of non-specific binding proteins(such as magnetic beads binding protein,etc.),high abundance of non-specific proteins may interfere the real IncRNA interacting protein.Therefore,we conduct experiments RNA PULL DOWN introduced SILAC quantitative proteomics technology.Finaly we got five candidate proteins for subsequent RIP authentication.We chose these five proteins because there were existing IP level antibodies for use.RNA immunoprecipitation samples were validated by semi-quantitative PCR and found CAPRIN1 were related with IncRNA CAT1257.CAPRIN1 was known to be overexpressed in more than 70%of breast cancers,and was closely related to the proliferation of tumor.The specific relationship between protein CAPRIN1 and lncRNA CAT1257 are still unknown.In conclusion,we combinated the data of the triple negative breast cancer tissue microarray and the transcript database“mitransciptome" to screen triple negative breast cancer related lncRNA.LncRNA CAT1257 was found to be specifically expressed in triple negative breast cancer,knockout of IncRNA CAT1257 in triple negative breast cancer cells can significantly inhibit cell proliferation.Protein CAPRIN1 was found to be interacted with lncRNA CAT1257.