Objective: Micro-RNAs(miRNAs)are short,18-24 bp,highly conserved,noncoding small RNAs.It has been reported that miRNAs are abnormally expressed in serum and cancer tissues of human cancer patients,and are closely related to the key roles of tumor suppressor genes/oncogenes.Overexpression of miR-29 s in osteosarcoma cells promotes apoptosis.However,the role of miR-29 s in human osteosarcoma has not been fully studied so far.MMPs are closely related to tumor growth and metastasis,but the expression of MMP-9 in human osteosarcoma cells and the interaction between miRNA-29 b and MMP-9 have not been reported in the literature.This article mainly evaluates the expression of miRNA-29 b in osteosarcoma and discusses its effect on the proliferation and drug sensitivity of human osteosarcoma MG-63 cell line,and explores the effect of exogenous miR-29 b on osteosarcoma cell proliferation and withering.The role and mechanism of death and chemotherapy sensitivity provide a new reference for the treatment of osteosarcoma.Methods:1.The human osteosarcoma cell line MG-63 was purchased from ATCC and cultured in DMEM medium containing 10% fetal bovine serum + 1% penicillin/streptomycin.The culture dish was placed in CO2 at 5% and the temperature was The cells were incubated at 37°C.Cells were seeded in 12-well plates at 1.5 x 105/well,followed by transfection at a concentration of 30 nM miR-29 b mimics and a negative control.2.Total RNA was extracted from the plasmid-transfected MG-63 cells,and mRNA was purified by a triple reagent according to the reagent instructions.Anhydrous RNase was used to solubilize total RNA and was extracted using agarose gel electrophoresis.The qRT-PCR method was used for quantitative analysis of miR-29 b mRNA.The sequence of each mRNA marker was queried by NCBI and qRT-PCR primers were designed by premier 5.The MMP-9 primer sequence is: F: 5'-ACGCAGACAT CGT CATCCAGT-3',R: GGACCACAACTCGTCATCGTC;GAPDH primer sequence is: F: 5'-ATGGGGAAGGTGAAGGTCG-3',R: 5'-GGGGTCAT TGATGGCAACAATA-3',according to SYBR The Prime Script PLUS RT-PCT kit instruction manual checks the relative level of mRNA for each sample.After the reaction,the mRNA levels of each marker were calculated and GAPDH was used as an internal reference.3.Tissue and cell samples were immediately soaked in lysis buffer containing protease inhibitors,then 12,000 rpm,centrifuged for 15 minutes,and supernatants were collected.The protein concentration was determined using the BCA protein assay kit.Antigen-actin and MMP-9,anti-human anti-actin mouse monoclonal antibody,anti-human caspase3 mouse monoclonal antibody,anti-human pro-caspase3 mouse monoclonal antibody,anti-human PARP mouse monoclonal antibody antibody Anti-human pro-PARP mouse monoclonal antibody was incubated with anti-human MMP-9 mouse monoclonal antibody.Detection was performed using a horseradish peroxidase-conjugated anti-mouse IgG secondary antibody and a PierceTM ECL immunospot kit,using a molecular imaging imager CheminDocTM XRS system.4.Annexin V-PI cell apoptosis detection kit to detect apoptosis.(Doxorubicin Treatment + miRNA Transfection)After two days of treatment,MG63 cells were collected and phosphate-diluted(PBS)washed,diluted with 400 ul of PBS to a concentration of 1 x 105 cells/ml,and 5 ?l of Annexin V-PI and iodine per plate.The propidium complex was mixed and the cells were thoroughly mixed and placed in a dark room for flow cytometric analysis of the FACScalibur.5.After transfection,the cells were counted and plated in 96-well culture plates at a density of 5 × 10 3 cells/well.The cell differentiation was then measured using the Kit-8 cell counting kit.After adding 10 ?l of CCK-8 per well,The plates were incubated in a 37°C incubator for 1 hour and their concentration values were measured at OD450.6.Clone formation experiments were performed by seeding MG63 cells with 1 × 103 cells/well in triplicate on 6-well culture plates.After two weeks of culture,they were stained with 1% cell crystal violet.The Olympus SH-50 was photographed and counted.ImageJ 1.47 software.7.Luciferase Report: Cells were added in triplicate at a cell concentration of 70-80% in a 24-well plate and co-transfected with a Gaussia Luciferase(GLuc)luciferase reporter plasmid and a SEAP luciferase plasmid.After 48 hours of transfection,the activity of GLuc and SEAP in the cell culture medium was analyzed using a secretion-pair dual fluorescence assay kit with reference to the reagent instructions.8.Statistical analysis: All experiments were independently repeated three times.The significance of the data was assessed by one-way ANOVA.Setting p<0.05 was considered statistically significant.Results:1.Differential expression of miR-29 b and MMP-9 mRNA in human osteosarcomaFirstly,the correlation between miRNA-29 b levels and clinicopathological features of osteosarcoma was studied.miRNA-29 b was associated with metastasis and clinical staging of osteosarcoma.miRNA-29 b levels in clinical stage I and II patients were higher than those in stage III and distant metastases.high.We detected lower levels of miR-29 b in osteosarcoma in human osteosarcoma than in paraneoplastic tissues.In contrast,the level of MMP-9 mRNA in osteosarcoma tissue was much higher than that in the paraneoplastic tissue.2.MG-63 cells were transfected with 25 or 50 nM miR-29 b mimics and miR-29 b controls.After 24 hours,miR-29 b and MMP-9 expression levels were detected by qRT-PCR;MG-63 cells were at 25 and 50 nM.Under the miR-29 b mimic,the expression of miR-29 b was increased by 100-fold or 150-fold compared with the miR-29 b control group,and the expression level of MMP-9 mRNA was reduced by 40% or 50% compared with the miR-29 b control group.Using immunoblot to detect the expression of MMP-9 protein,it was found that the expression of MMP-9 was significantly inhibited.In MG-63 cells transfected with 25 and 50 nM miR-29 b mimics,the protein expression levels of MMP-9 were downregulated by 57% and 65%,respectively.3.In order to clarify the mechanism of the interaction between miR-29 b and MMP-9 in MG-63 cells,we constructed a luciferase 5' UTR wild or mutated MMP-9,wild or mutated 5' UTR human MMP.-9 was inserted in a plasmid for the luciferase gene.MiR-29 b was designed to target 5' UTR human MMP-9.After transfection,it was found that miR-29 b transfection inhibited luciferase 40% and 60% in the presence of 25 and 50 nM miR-29 b mimics.Activity.However,miR-29 b had no effect on the expression of the mutant 5' UTR luciferase MMP-9.4.In order to examine the inhibitory effect of miR-29 b on the growth of MG-63 cells in vitro,MG-63 cells were transfected with 50 nM miR-29 b mimic or control,and cell growth was detected with CCK-8 at different time points.Cells transfected with the miR-29 b mimic had the lowest viability at all time points compared to survival.MG-63 cells were added dropwise to 12 wells(50 cells per well)for 12 hours and then transfected with 50 nM of miR-29 b mimic or control.Then,the colony morphology of MG-63 cells in each group was observed.The miR-29 b mimic was found to have significantly reduced colony size compared to the miR-29 b control group.5.The effect of miR-29 b on apoptosis of MG-63 cells induced by doxorubicin was detected by flow cytometry.After miR-29 b transfection,the apoptosis rate of doxorubicin-induced MG-63 cells increased by 37.5%.Different groups of caspase 3 or PARP were quantified by Western blotting.The expression of caspase 3 was highest in MG-63 cells + doxorubicin + 50 nm miR-29 b mimics,and the ratio of pro-caspase 3/caspase 3 and pro-PARP/PARP was 40% for miR-29 b transfection.27%.Conclusion:1.The level of miR-29 b in osteosarcoma tissues is decreased,and the level of MMP-9 is increased.MiR-29 b is highly expressed in metastasized osteosarcomas and later stage cancer tissues,whereas MMP-9 is the opposite.2.miR-29 b inhibits MMP-9 expression in osteosarcoma cells.3.miR-29 b can inhibit osteosarcoma cell differentiation and promote its apoptosis.4.miR-29b/MMP-9 may be an important mechanism involved in the pathogenesis of osteosarcoma. |