The Association Of MiR-194、TSP-1mRNA In Patients With Diabetic Kidney Disease Through Induction Of Endoplasmic Reticulum Stress

[Objective]Recent discoveries showed that the endoplasmic reticulum(ER)stress initiates a new pathway of apoptosis which has been widely demonstrated in multiple orgen dysfunction in diabete mellitus(DM).Glucose-regulated protein 78(GRP78),also called immunoglobul in heavy chain binding protein(Bip),is a specific molecular partner of ER.The unfolded protein response(UPR)was initiated by GRP78 through ER stress pathway.All UPR pathways of trigger apoptosis by inducing CCAAT/enhancer binding protein homology protein(CHOP),which is a classical marker of ER stress regulation.The expression of serum circulating miR-194 and TSP-1mRNA,along with the expression of classic ER stress preteins GRP78 and CHOP,in type 2 diabetes mellitus(T2DM)and different renal fuction in diabetic kidney disease(DKD)were intended to investigate the relationship between miR-194 and TSP-1mRNA through ER stress pathway.[Methods]1.The blood samples of both T2DM patients and normal people were collected.The serum was separated by centrifugation.General clinical data was analyzed by Beckman Coulter AU5800 Automatic Biochemical analyzer(Beckman Coulter,Inc,USA).2.For the extraction of miR-194 and TSP-1mRNA with a quantitative real-time polymerase chain reaction(qRT-PCR).We used qRT-PCR to determination the expression levers of serum circulating miR194 and TSP-1mRNA.In all the data,the expression level of miR-194a-5p was analyzed using cel-miR-39(UCACCGGGUGUAAAUCAGCUUG)(Mature miRNA Sequence)as external reference,and glyceraldehyde-3-phosphate dehydrogenase(GAPDH)as internal reference for TSP-1mRNA,The upstream and downstream sequences of primers are respectively:Forward 5’GGATTTGGTCGTATTGGGCG-3’,Reverse 5’-TCCCGTTCTCAGCCATGTAG-3’,using the method of 2-ΔΔCt for analyzing expression level.3.Using correlation analysis to determination the association among the circulating miR-194 and TSP-1mRNA and general clinical indicators.Among them,the expression data of circulating miR-194 and TSP-1mRNA were the results of 3 repeated experiments,expressed as mean 1SD.Two independent samples were compared using T test.One-way ANOVA was used for comparison of the mean values of multiple samples.P<0.05 indicated that the difference was statistically significant.All statistical analyses were performed using statistical software SPSS 22.0 and Graphpad Prism 8.4.Enzyme linked immunos-orbent assay(ELISA)was used to extract classic proteins GRP78 and CHOP of ER stress in serum.Using correlation analysis was investigate the circulating miR194 and TSP-1mRNA,along with the expression levels of circulating classic ER stress proteins GRP78 and CHOP.5.Rxeceiver operating characteristic(ROC)curve was used to predicted the association between of diagnostic value the differentially expressed circulating miR-194 and TSP-1mRNA in DKD patients.To further analyze whether serum circulating miR-194 and TSP-1mRNA are superior to urinary microalbumin,eGFR and cys-c in the screening and assessment of the severity of early DKD patients.[Results]1.In the first chapter,it was found that miR-194 was significantly raised in T2DM patients in comparison to the normal control group(P=0.029,<0.05),suggesting it is diagnostic value for T2DM.According to the quantitative methods of eGFR and urinary microalbumin(UmALB/Cr),all the T2DM patients were divided into three groups:①group A:normal albuminuria group,UmALB/Cr<30 mg/g;②group B:microalbuminuria group,UmALB/Cr between 30～299 mg/g and eGFR is greater than 30 ml/min/1.73m2;③group C:UmALB/Cr>300 mg/g,or 24-h urinary quantitative>0.5 g,or Cr>97μmol/L(male),or Cr>73 μmol/L(female).The espression level of serum circulating miR194(P=0.007,<0.05)among 3 groups was a significant statistically difference.It is assumeded that miR-194 could be diagnostic marker for DKD with varying degree of renal impairment.Moreover,miR-194 is correlated with the DM course,Cr,BUN,UmALB/Cr,TG,AFP,Cysc,D-Dimer and eGFR(P=0.006,0.000,0.000,0.000,0.032,0.043,0.000,0.017,0.002,all<0.05).We used multiple linear stepwise regression analysis in serum circulating miR-194 to find UmALB/Cr was an independent influence factor(β=0.005,P=0.028).Using ROC curve to evaluate the diagnostic value for DKD of serum circulating miR194,and the area under the curve between miR-194 and normal control group was 0.623(95%CI:0.4210.748;P<0.01),with evaluation value.Therefore,miR194 has definite diagnostic accuracy in the diagnosis of T2DM and early DKD,and can be considered as a biomarker for the diagnosis of DKD.2.Compared with the normal control group,we found that the expression level of serum circulating TSP-1mRNA(P=0.024,<0.05)was significantly increased in T2DM patients,which indicating its diagnostic value for T2DM in second chapter of this study.There was a significant statistically difference in the espression level of TSP-1mRNA(P=0.040,<0.05)in group A,group B and group C.With aggravation of renal function,the expression of TSP-1mRNA was gradually increased.Correlation analysis found that TSPlmRNA was positively correlated with Cys-c(r=0.281,P=0.021)and UmALB/Cr(r=0.317,P=0.009).Multiple linear stepwise regression analysis showed that Cys-c(β=0.578,P=0.021)and UmALB/Cr(β=0.001,P=0.009)were independent influencing factors of serum TSP-1mRNA.3.We found that the expression of circulating GRP78 of T2DM patients was significantly raised in the normal group,as to the expression of CHOP was decreased.The GRP7 8 and CHOP levels has significant statistically difference between the groups of the normal and T2DM group(P=0.000,<0.05).In patients with different degrees of DKD,GRP78(P=0.011,<0.05)and CHOP(P=0.008,<0.05)were statistically significant different betweed the two groups,suggesting the presence of ER stress in the course of DKD.Correlations between GRP78 and CHOP and clinical biochemical indexes of T2DM were analyzed by pearson or sperman methods,GRP78 was positive correlation with fasting Cpeptide(FCP)(r=0.258,P=0.045),creatinine(Cr)(r=0.401,P=0.001),Cys-c(r=0.426,P=0.000),serum uric acid(sUA)(r=0.360,P=0.003),but negative with eGFR(r=-0.319,P=0.009)and CHOP(r=-0.256,P=0.037).Further analysis found that miR-194 was negative with CHOP(r=-0.301,P=0.001),AFP(r=-0.222,P=0.018)and eGFR(r=-0.282,P=0.003),was positive correlation with FPG(fasting plasma glucose)(r=0.193,P=0.036),UmALB/Cr(r=0.446,P=0.000),Cr(r=0.260,P=0.005),Cys-c(r=0.339,P=0.000)and quantitative insulin sensitivity check index(QUICKI)(r=0.250,P=0.006),suggesting that miR-194 was in fact correlated with DKD through ER stress.[Conclusions]In this study,the expressions of miR-194,TSP-1mRNA and GRP78 were significantly increased in T2DM patients,while CHOP expression was decreased,and it was also statistically significant in patients with different urinary protein diabetes.ROC curve was found with other commonly used assessment kidney index such as creatinine,blood urea nitrogen,cystatin C,UmALB/Cr,eGFR,has certain clinical value,in order to further studies on the role of miRNAs in the pathogenesis of DKD.Our study provides a new direction for the diagnose and treatment of DKD from perspective fo the ER stress pathway.