| Three bacterial strains P-1, P-2 and P-3 were separated from the active sludge of petroleum refining waste water from Nanchong refinery and oil-contaminated soil in the suburb of Chengdu city. The petroleum refining waste water was treated by P-1, P-2 and P-3 separately using the biofilm under laboratary condition. The order of treatment effect was P-3> P-1> P-2, P-3 was better than active sludge of petroleum refining waste water on treating petroleum refining waste water.The experiment showed that 30℃-35℃ and pH8.0 were the optimum treatment condition of P-3. Petroleum refining waste water, being treated by P-3 under the condition of 30 ℃, 1. 25L/min and pH8.0, the oil content decreased from the beginning 0. 285 to 0. 009, removal rate being 97% and the COD value from the beginning 402.16 mg/L to 81.17 mg/L, removal rate of being 80%.Aiming at removing the naphthalene, on behalf of PAHs, in petroleum refining waste water, naphthalene degradation bacterial strains N-l and N-2 which could use naphthalene as the sole carbon source for growth, were screened respectively from oil-contaminated soil in the suburb of Chengdu city and the active sludge of petroleum refining waste water from Nanchong refinery. It showed that the naphthalene degradation rate of N-l was better than N-2 and active sludge of petroleum refining waste water could not degrade naphthalene in experiment. After systematic study of N-l, its optimum growth condition was 35 ℃ and pH8.0. Degradation rate behaved best with the addition of 0.1%( V/V)trace elements solution combined with the 1000mg/L NH4NO3 as best nitrogen source at 180rpm.The degradation rate was above 94.7% when concentration of naphthalene was below 500mg/L.According to the cell morphology and physic-biochemical experiments, the bacterial strain P-3 and N-l were preliminarily identified as Pseudomonas and Micrococcus respectively. 16SrDNA of P-3 and N-l were amplified by PCR using a pair of primers PI ( AGAGTTTGATCCTGGTCAGAACGAACGCT ) and P6 (TACGGCTACCTTGTTACGACTTCACCCC) ,which were modified .The result showed the pair of primers was good for amplifying 16SrDNA of P-3 and N-l. |