Studies On Transcription Of Bph Gene Cluster And The Metabolism Pathway In Dyella Ginsengisoli LA-4

Polychlorinated biphenyls which have been widely used for various industrial and commercial purposes are well known as one of the most famous environment pollutant for their carcinogenicity, neuroendocrine, developmental and reproductive toxicity. Therefore, the study on the biodegradation of biphenyl/PCB has very important theoretiea meanings and application values. Dyella ginsengisoli LA-4 is a newly isolated biphenyl degrader, which can utilize biphenyl and 4-chlorobiphenyl as the sole source of carbon and energy. To better understand the mechanism of biphenyi metabolism in strain LA-4 and fully tap the strain resources, the mechanism of bph gene cluster transcription and the lower pathway of biphenyl degradation was studied in this thesis.There is a gap of 188 bases between bphXO and bphXl containeding a promote r as following:AGATTGAACTGCGGCGTGACTCCGTCGGAGAAATTGTCCCTTGGG ACGCA, which was obtained via a promoter predication. Moreover, there was a prom oter located on the upperstream of bphXO rather than the downstream in P. pseudoalc aligenes KF707. These mean the physic map of bph gene cluster in strain LA-4 was different from KF707 which had the highest homology with strain LA-4.Though the promoter was not heterologously expressed in E.coli successfully, the result of RT-PCR was proved the present of the promoter. With the promoter as separation, gene cluster of bphLA-4 is transcribed as two operons, i.e. bphA1A2 (orfl) A3A4BCX0 and bphX1X2 (orf2) X3D, which is similar with that of bphKF707. Furthermore, the expression of both operons in bphLA-4 could be induced by biphenyl, catechol and benzoate rather than glycerol. These showed the growth substrate was very impotant to the ability for biphenyl degradation of strain LA-4.One of the metabolic products of biphenyl degradation by strain LA-4 was isolated and identified as trimethylsilyl derivatization product of 2-hydroxyhexa-2,4-dienedioic acid via GC-MS. Conprehension the function of genes in bphLA-4 and experimental results, a pathway of biphenyl/PCBs degradation by strain LA-4 was proposed. Biphenyl/PCBs are degraded to (chloro-) benzoate and 2-hydroxypenta-2,4-dienoate in BphABCD catabolic order. Benzoate generated from biphenyl/PCBs is degraded through catechol mate-cleavage pathway to form HODA, which is then metabolized to 2-hydroxypenta-2,4-dienoate. And 2-hydroxypenta-2,4-dienoate is degraded by BphX1X2X3 to the TCA cycle. The lower pathway is different with other typical biphenyl degraders such as P. pseudoalcaligenes KF707, B. xenovorans LB400, Rhodococcus jostii RHA1, Acidovorax sp. KKS102. This infrequent type of biphenyl/PCBs metabolic pathway only found in Pseudomonas cepacia P166 However, there has yet been little information about genes for metabolic pathway in Pseudomonas cepacia P166. Here, we firstly supply some molecular biological information on this uncommon metabolic pathway to understand biodegradation of biphenyl/PCBs deeply.