| IntroductionThe cytomegalovirus ( CMV) infection is the most common infective disease in newborn. CMV infection in newborn may impair many organs and cause many different symptoms. Now there are some research works done in transmission channel between mother and newborns, and clinical therapy, but the research of pathogenicity of CMV have no final conclusion yet. to today, there are few data about the research for pathogenicity of different CMV genotype. 111 urine samples of CMV in newborn patients were amplicated by using polymerase chain reaction (PCR) , and restriction fragment length polymorphism ( RFLP) was used to detect gB genotypes of CMV.Methods1. DNA extraction. CMV DNA from the urine samples of 111 CMV newborn patients have been extracted. All clinical data of the cases were recorded.2. Nested - PCR amplication and amplicon identification. CMV gB gene was amplified by PCR with 5'primers 1: GTTCCGAAGCCGAAGACTCG, 2: GCAGCACCTGGCTCTATCG, 3: GCCAGCTCACCTTCTGG and 3' primer: GCACCTTGACGCTGGnTGG. Inner 5' primer TGGAACTCGAACGTITGGC and 3' primer GAAACGCGCGGCAATCG . Nested - PCR was performed in a 50μl reaction mixture by TaKaRa TaqTM PCR kit. PCR amplification was done under the following conditions; denaturation at 95℃ for 4 min,35 cycle of denaturation (60s) at 95℃,annealing (45s) at 55℃,and extension (45sec) at 72℃, extension at 72℃ for 5min. Amplified products were analyzed by electro-... |