| Diabetic nephropathy(DN) is the result of the systemic microvasal pathological changes,and one of the common chronic syndromes of diabetes mellitus(DM).Nowadays, DM has been becoming a tertiary chronic disease of endangering people,just inferior to the tumors and cardiopathy as well as encephalopathy.There are about 135 million diabetics all over the world,and 30-40 million in China,at the same time, domestic morbidity had been rising in recent years.The occurrence of clinical albuminuria in DN indicates the bad prognosis, namely the DN usually rounds into the end stage renal disease, which burdens the individual and the society heavily.Therefore it is important to take measures to arrest the clinical phase of DN or decrease the incidence rate of clinical phase of DN in the early stage of microalbuminuria phase of DN.The experiment included two parts to research shenkang pill (肾康丸) treating with DN.The first part investigated the potential optimal recipe of shenkang pill compound through the orthogonal design experimentation,in order to determine the potent herbs against microalbuminuria,and further to test the facticity of optimal recipe through the comparison of the renoprotective effects of DN rats with the original recipe. The second part investigated the effect of shenkang pill on the expression of transforming growth factorβtypeâ…¡receptor(TβRâ…¡) by immunohistochemistry and reverse transcription polymerase chain reaction (RT-PCR).Chapterâ… Optimization of the Shenkang Pill recipe by Orthogonal DesignObject:To investigate the effective herbs and the optimal dosage in the formula of Shenkang Pill treating DN with orthogonal design.Methods: The shenkang pill, which was consisted of astragalus root(A), B,hirude nippoica whitman (C),D,E and corn stigma (F), was fixed on three levels dosages respectively on base of clinical experiences and the common dosage, formed 27 recipes according to the orthogonal table L27 (313), and streptozotocin (STZ)-induced DN model rats with unilateral nephrectomy were received daily gavage for 8 weeks with the respective lixivium of shenkang Pill(3 g/ml, 1.08ml/220 g wt), in order to determine the effective antiproteinuric herbs and optimal dosage in the formula by the parameter of uric albuminuria excretion(UAE) in the end of the treatment. In the further step, 40 treptozotocin (STZ)-induced DN model rats with unilateral nephrectomy were divided into 4 groups, DN group(n=10) and DNS group(n=10),DNY group(n=10),DNK group(n=10), plus additional 10 rats with unilateral nephrectomy as the normal control group(NC), the NC and DN group received daily gavage with the saline water (1.08 ml/220 g wt), and the DNS,DNY,DNK group with lixivium of Shenkang pill and the optimized Shenkang Pill(3 g/ml, 1.08 ml/220 g wt) as well as the solution of Angiotensin converting enzyme inhibition(ACEI) Capoten (4.5 mg/Kg wt) for 8 weeks, in order to compare the renalprotection through examinating the parameters of body weight,kidney weight,relative kidney weight (kidney weight/body weight),blood sugar,blood urea,serum creatinine(SCr),total cholesterol and triacylglycerol.Results:1,The factor A,C,F in the formula demonstrated significant medicable effects against the UAE(P<0.040), but not with the factor B,D,E (P>0.056). The cross effects between A & B, A & C as well as A & F didn't existed (P>0.175).2,The significance sequence of the factors to the UAE was A>F>C, and the moderate dosage of A,B,C,F and the minimum dosage of D,E constituted the putative optimal recipe.3,There was no significant difference between the original and the putative optimal recipe as tothe renalprotection.4,The test of UAE: The levels of UAE had no differences among the models(P =0.607), and significantly increased comparing with the NC group(P<0.05). After the administration the UAE decreased significantly in the DNS,DNY,DNK groups (respective t values -5.188,-3.522,-3.766; P<0.013), but still higher than the NC group(P<0.05), The UAE increased significantly (t=3.072, P=0.028) in the DN group, there was significant differences comparating with the DNS,DNY,DNK after the administration(P<0.05), and there were no significant differences as to the UAE among the DNS,DNY,DNK groups after the treatment (P>0.337).3,The parameters of body weight,kidney weight,kidney weight/body weight,SCr,blood urea,total cholesterol and triacylglycerol had no significant differences between the DNS and DNY group(P>0.069). Comparing with the DNK group, the kidney weight/body weight,SCr,blood urea in the DNS and DNY group had no significant differences (P>0.093), but the body weight both in the DNS and DNY group were weightier than the DNK group(P<0.05), with total cholesterol and triacylglycerol lower significantly than the DNK group(P<0.05). Except the kidney weight and the SCr, the other parameters were ameliorated in the DNS and DNY group comparing with the DN group, but inferior to the NC group(P<0.05). The mean rank of blood sugar of the DNS was close to the DNY group's, both of which were lower than the DNK and DN group while higher than the NC group.4,The histopathologic lesions in the DN was severe, characterized as interstitial fibrosis, mesangial expansion and matrix deposition obviously, with hypertrophy of the glomerular, contrasting to the DNS,DNY,DNK groups with alleviative hypertrophy of the glomerular and mild mesangial expansion and matrix deposition.Conclusion1,The factors A,C,F in the formula demonstrated significant medicable effect against the UAE, the B,D,E might act as accessorial element. The cross effects between A & B, A & C as well as A & F didn't existed.2,The significance sequence of the factors to the UAE was A>F>C, the result of the optimization was that the original recipe was the optimal recipe.3,Not only was the shenkang pill's renalprotection similar to the Capoten, but it could exert multitarget renalprotection, displayed the advantages of Chinese traditional medicine in the fields of renalprotection in DN.Chapterâ…¡Effects of the shenkang pill to the TβRâ…¡in the kidney cortex of the diabetic nephropathy ratsObject:Research the TβRâ…¡antigen and gene expression, and the effects of the shenkang pill to the expression of TβRâ…¡in the kidney cortex of the DN rats.Method: 1,Immunohistochemistry.Paraffin sections were incubated 2 times in xylene for 10 minutes, and twice in 100 % ethanol for 2 minutes, and then hydrated the slides by placing in 95%, 80%, 70 % ethanol and water for 2 minutes, then inactivated the peroxidase by incubating for 30 minutes in 3 % hydrogen peroxide. Afterwards, washed the slides in PBS buffer for 20 minutes. Blocked the slides with 10 % goat serum for 30 minutes at indoor temperature, removed the excess buffer and then incubated the slides in a humidified chamber overnight with primary antibody(75μl rabbit anti-TβRâ…¡(1: 100)), then rinsed the slides with a gentle stream of PBS buffer thrice, and then incubated with secondary antibody(goat anti rabbit IgG) labeled with peroxidase for 15 minutes at indoor temperature, and then rinsed the slides with a gentle stream of PBS buffer thrice, finally, incubated in fresh DAB solution, stopped the reaction by washing in running water when a uniform brown color first became visible on the section, and rinsed the slides with a gentle stream of PBS buffer thrice. Incubated the slides in hematoxylic solution for 5 minutes, and then washed in running water, dehydrated in 70%, 80%, 95%, 100% ethanol for 2 minutes, incubated in xylene for 10 minutes, and envelopped section with neutral balata. Got three sections from each group randomly, and 10 glomerular and interstitial fields of vision from each sections zoomed in 200 times by microscope, scored the stain according to the stain area and the shade of colour. Negative stain scored zero, buff stain or less than a quarter stain of the field of vision scored 1, yellow stain or a quarter to a half stain of the field of vision scored 2, brown or nigger-brown stain or more than a half stain of the field of vision scored 3.2,In the end of the experiment, got four rats randomly from each group, executed the rats and got the kidney, the kidney weight was measured, then got rid of the membrane, washed it with the cool water pretreated with 0.1% DEPC, and then scissored about 0.1 g kidney cortex, kept in the—80℃refrigeratory with EP tubes. In the next step, extracted the total mRNA by Trizol and the TβRâ…¡gene expression was messured by semi-quantitative RT-PCR: using the One-Step RT-PCR Kit:5μl of total RNA and 0.3μl (20 mmol/L) anti-sense TβRâ…¡specific primers(5'CAGGTCATCCACAGACAGAGTAGG3'). 5 minutes later at the temperature of 70℃, added the sense TβRâ…¡specific primers(5' GCAGAACACTTCAGAGCAGTTTG 3') and 0.1% DEPC pretreated water to 20μl. The same method with the control GAPDH was carried out(sense sequence: 5'AGATCCACAACGGATACATT3'; anti-sense sequence: 5'TCCCTCAAGATTGTCAGCAA3'). Synthesized the cDNA template at 42℃for 1 hour, and inactivated the reverse transcriptase and predenaturalized the cDNA at 94℃for 5 minutes. The PCR thermal cycler conditions: 94℃30 s, 55℃1.5 minutes, 72℃, 2 minutes, 30 cycles, in the end extended the product at 72℃for 7 minutes. The final product was electrophoresed in the 2% agarose gel, visualized by EB, analyzed by Gel Doc1000, the content of TβRâ…¡fragment and GAPDH fragment were compared.Result:1,The positive stain, which characterized as buff to brown and nigger-brown, mostly localized tubular or interstitial cells at the cytoplasm and the membrane, but faint stain in the glomerular (tubular or interstitial versus glomerular stain Z=—6.165, P<0.001). There were significant differences among the NC,DN,DNS,DNY,DNK group due to the glomerular stain scores(χ2=15.163, P=0.004) and the similar way to the tubular or interstitial stain(χ2=39.252, P<0.001). The mean rank of the stain scores in the DNS,DNY,DNK group were nearly equivalent but higher than the NC group while lower than the DN group obviously.2,There was significant differences on the expression of TβRâ…¡mRNA among the five groups (F=94.674, P<0.001), each of the DNS,DNY and DNK were lower than the DN group(P<0.05), and no significant differences among the three groups(P =0.402), but both the DNS and the DNY higher than the NC group(P<0.05).Conclusion:1,The expression of TβRâ…¡antigen mostly localized at the tubular or interstitial cells, but faint in the glomerular cells.2,The shenkang pill displayed remarkable renalprotection effects, paralleled the ACEI Capoten's down-regulation the expression of TβRâ…¡antigen and mRNA, which might be one of the mechanisms that the shenkang pill exerted renalprotection effects. |