| Background and objective:Chronic cerebral ischemia is a frequent pathologic state of nervous system (NS). It always concomitant with many diseases such as vascular dementia(VD) Alzheimer disease(AD) Binswanger's disease and so on. Harmfulness of the cognition ability is the main manifestation in the earlier period, and lead to the persistent or advancing dysfunction of cognition and nerves at last. For this reason, the study of pathogenesis and drugs has the widespread significance for the clinical prevention and cure to chronic cerebral ischemia.One of the pathologic foundations of chronic cerebral ischemia is that devils of p-amyloid protein (Aβ) precipitate in the cerebral cortex and other encephalic region. Aβis a difficult solvable protein, composed of 42 amino acid residues generally. The molecular weight is about 42kDa. It is hydrolyzed fromβ-amyloid precursor protein (APP).The hippocampal formation is a bilateral structure sandwiched between the cerebral cortex and the thalamus. It is very sensitive to the ischemia.Butylphthalide is an 1-isomer extracted from celery seed. Then it was made racemic by artificially synthesize. After years of investigation, scholars found that dl3 normal-butylphthalide is effective to acute ischemic stroke. But there is lots of study and research have to do to proof whether it is effective or not to chronic ischemic stroke.In our study, we use three methods to survey the variance of the APP expression in different drug intervention group. The methods include immunohistochemistry reverse transcription- polymerase chain reaction(RT-PCR) immunodotting. Our study will provide whether it's effective to chronic ischemic stroke.Materials and methods:1. Subgroup of animal and preparation of models:150 healthy Wistar rats, female or male, 12-14 months old, weight 450-550g. The rats were randomly divided into 5 groups: model group(A) control group(B) obviate group(C) low dose group(D) high dose group(E). 30 rats in every group. Control group (B) only exposed double common carotid artery, no ligation. Else groups ligated double common carotid artery. Obviate group(C) was given butylphthalide 80mg.Kg-1.d-1 one month before ligating double common carotid artery, model group(A) low dose group(D) high dose group(E) were ligated two months before giving drug, after two months, group A was given placebo, group D was given butylphthalide 60mg.Kg-1.d-1 , group E was given butylphthalide 120mg.Kg-1 .d-1 , one month continue. Then 3 months later we executed the rats.2. Collection of the specimen:(1)For immunohistochemistry experiment: after the rats were anesthetized with 10% Chloral Hydrate and lavaged with Sodium Chloride, we took out of the rat brain quickly. Then fixed with paraformaldehyde, dehydration with gradient alcohol, made it transparent with Xylene, embeded with paraffin wax, cut sheet and reserve.(2)For RT-PCR and immunodotting experiment: after the rats were anesthetized with 10% Chloral Hydrate, we took out of the rat brain and reciped blood quickly, then separated the brain on ice, built in 1.5 mL EP tube, maintained in - 80℃and reserve.3. Immunohistochemistry experiment:(1)Antibody: First antibody: rabbit anti-APP monoclonal antibodySecond antibody: HRP marked goat anti-rabbit polyclonal antibody (2)Procedure: parch, deparaffinage, antigen reparation, blood serum blocking, addin first antibody, addin second antibody, colouration by DAB, hematoxylin counterstain, differentiation, mounting.(3)Photograph and analyze.4. RT-PCR:(1)Extraction of tot RNA: Trizol liquid were used.(2)Reverse transcription- polymerase chain reaction:* Primer:β-actin: 5' GGGAAATCGTGCGTGACAT 3'5' TCAGGAGGAGCAATGATCTTG 3' APP: 5' GGGTCTGGGTTGACAAACATC 3'5' CATTCTGCTGCATCTTGGAGA 3'* 25ul system, 50℃, 15min, cDNA synthesis;94℃, 2min, force-degeneration; 94℃, 30s, degeneration; 56℃, 30s, annealing; 72℃, 1.5min, extension ; 4℃, forever.* Agarose gel electrophoresis.(3)Photograph and analyze.5. Immunodotting experiment:(1)Extraction of tot protein: single decontaminant lysate were used.(2)Immunodotting experiment:* Antibody: First antibody: mouse anti-rat IgG1 APP monoclonal antibodySecond antibody: HRP marked goat anti-mouse polyclonal antibody* Procedure: dilution of antigen (1:20), spotting, blocking, addin first antibody, addin second antibody, colouration by DAB.(3)Photograph and analyze.6. Statistical treatment:All date were entered into a computer and analyzed using software SPSS 13.0 for windows. The date were presented as means±SD( x±s).one way analysis of variance was used to determine significant differences among five groups, and Q-test was used to determine significant differences between each groups. The significant testing standard wasα=0.05.Results:1. Ethology appreciation of different stage dislapyed that: after the operations, all the animals behaved depressed, responded slowly; One day after the operation, group B recovered, some rats of the else groups showed up ataxia; One week later, they began to recover; after dosage, group C D E improve gradually, Group E is the most obviously.2. From immunohistochemistry experiment we can find that there is no obviously ab -normality in group B. The shape and alignment of pyramidal cell in hippocampus is abnormality in group A and the staining is the deepest. Group C is better than group A and D, but can not compare with group B. There is no abviously differenc -e between group C and E.3. The immunohistochemistry experiment showed the average dates of the APP positive area which reflect the APP expression of protein level in hippocampus CA1 were: group A 91.612±4.562, group B 69.543±1.659, group C 84.499±2.005, group D 82.098±2.118, group E 76.593±2.342; the one-way analyse of variance show that F=92.899, P=0.000, there was significant difference between groups; Q-test displayed that group A compare with else four group P<0.05, group B compared with group C. D E, P<0.05, group C compared with group D, P>0.05, group C compared with group E, P<0.05, group D compared with group E, P<0.05, the comparation between groups all have significance except C and D.4. The RT-PCR experiment showed the average dates of the corr. APP optical density value(OD value) which reflect the APP mRNA expression in hippocampus were: group A 105.851±6.372, group B 72.350±16.368, group C 94.650±2.728, group D 93.684±3.982, group E 85.182±5.275; the one-way analyse of variance show that F=92.899, P=0.000, there was significant difference between groups; Q-test displayed that group A compare with else four group PO.05, group B compared with group C D E, P<0.05, group C compared with group D, P>0.05, group C compared with group E, P<0.05, group D compared with group E, P<0.05, the comparation between groups all have significance except C and D, it was identical with result 3. The average dates of theβ-actin optical density value(OD value) which reflect theβ-actin mRNA expression in hippocampus were: group A 166.333±11.487, group B 161.138±13.974, group C 161.631±11.184, group D 165.509±11.368, group E 164.267±16.551; the one-way analyse of variance show that F=0.312, P=0.869, there was no significant difference between groups.5. The immunodotting experiment showed the average dates of the APP optical density value(OD value) which reflect the APP expression of enzyme-linked immunospot protein level in hippocampus were: group A 39.757±7.928, group B 14.016±2.888, group C 31.149±7.300, group D 28.107±6.586, group E 20.657±3.541; the one-way analyse of variance show that F=29.545, P=0.000, there was significant difference between groups; Q-test displayed that group A compare with else four group P<0.05, group B compared with group C, D E, P<0.05, group C compared with group D, P>0.05, group C compared with group E, P<0.05, group D compared with group E, P<0.05, the comparation between groups all have significance except C and D, it was identical with result 3 and result 4.6. The results of three experiments are coherent. The mean value of APP mRNA and protein expression in group A was the biggest, the group B was the least, after dosage the mean value of APP mRNA and protein expression in group C groupD and groupE descented obviously, and groupE |