Screening And Analyzing Mimic Epitope Of The Echinococcus Multilocularis Antigen Em18

Objective:To screen special mimic epitopes of Echinococcus multilocularis antigen Eml8 from phage 12-mer peptide library for exploring new diagnostic antigens.Method: The rEm18-GST fusion protein was expressed by induction with IPTG and purified by His Bind Resin.The polyclonal antibodies(pAb)against rEml8-GST were produced by immunizing rabbits.Use ELISA to check the titer of polyclonal antibodies.Purified the polyclonal antibodies with His Bind Resin and identified by ELISA and Western blot. Screened the phage 12-mer peptide library for 5 rounds.Randomly picked out 19 clones, extracted DNA and analyzed by sequenceing.Results:Expressed Em18-GST recombinant proteins can be detected at the band of 50kDa by SDS-PAGE.The titer of the antibodies was 1:51200 after 5 times'immunizing.The crossing reaction with GST was deleted after purified,which was testified by Western blot and ELISA.The 19 clones obtained have 4 same amino acid sequences after sequencing,they are as follows: Sequence 1:GTTGCGGCTTCTCCTAAGTGGACTAATCTTGAGTGG(f1-f4,f10); Sequenced 2:CATTCGAAGTGGCATATTCCGTCTGAGTGGCATGTG(f5-f9); Sequence 3:CAGCATGGGCATAAGATTTGGTCGCCGAGTTATGTT(f11-f12,f14); Sequence 4:CATCATTGGAGTTATTTTTATATTTTGGAGAGTCCG(f13,f15-f19). Compared these 4 sequences with Em18,they showed no homology with Em18. Conclusion:The anti-Em18 polyclonal antibodies which do not have the crossing reaction with GST were got.The sequences obtained were needed the future research.