| ObjectiveOveracter bladder is the most common bladder dysfunction in clinic.There is lots of study about the mechanism of it.Some study foundβ3-adenoreceptor(β3-AR) plays an important role in relaxation of smooth muscle of bladder andβ3-adenoreceptor gene SNP(single nucleotide polymorphisms) has close correlation with its function.We Comparatively analyze Trp64ArgSNP mutation rate and genotype ofβ3-AR between OAB patients and normal control group and compare length diversity of detrusor cell in OAB patients withβ3-AR mutation and other control groups after activated by different BRL37344 concentrations to make it clear thatβ3-AR gene mutation is one of the reasons of incidence of OAB and drug resistance in therapy.Methods1.ObjectsChoose 20 patients who were confirmed with detrusor instability by clinical urine dynamics detection(with more than 15cmH2O phase contraction of detrusor in filling phase of bladder) and 10 normal controls.Restriction enzyme BstN I was used and the enzyme incision site was CC↓(A/T) GC.BRL37344(SIGMA Company).2.Comparatively analyze Trp64ArgSNP genotype and gene mutation rate in OAB and control group.Extract DNA and perform PCR.Primer 1:CGCCCAATACCGCCAACACPrimer 2:CCACCAGGAGTCCCATCACC Enzyme incision reaction system:15μl PCR product,0.5μl BstN1,2μl 10×Buffer,0.2μl 100×BSA,2.3μl H2O.Condition:digest at 60℃water bath for 2.5 hours.4%agarose gel electrophoresis at 90V for 40~60minutes until anterior border of bromophenol blue reached the bottom of the gel.Analyze the results with auto-electrophoresis gel imaging analysator.3.Comparatively analyze the relationship ofβ3-AR Trp64ArgSNP and length diversity of detrusor cell in the effect of selectiveβ3 adrenergic agonistsThe detrusor cells which have been digested were divided into 3 groups:OAB group withβ3-AR Trp64ArgSNP,OAB group with wildβ3-AR and control group with wildβ3-AR.Add 100μl BRL37344(three concentration—10-7,10-6,10-5,10-4mol/L) into the 3 group,The length diversity of detrusor cell was observed by inverted microscope.Results1.β3-AR Trp64ArgSNP genotype and gene mutation rate in OAB and control groupsIn 22patients of OAB group,12 patients hadβ3-AR Trp64ArgSNP,the mutation rate was 55%including 3 homozygote,mutation rate of 14%,9 heterozygote,mutation rate of 41%.In 20 patients of control group,4 hadβ3-AR Trp64ArgSNP,the mutation rate was 20%,and both were heterozygote.The mutation rate difference of the two groups was prominently different(X2=5.30,P<0.05).2.The relationship ofβ3-AR Trp64ArgSNP and length diversity of detrusor cell in the effect of selectiveβ3 adrenergic agonistsAt different concentration of isoprenaline(10-7,10-6,10-5,10-4 mol/L),we analyzed the length diversity produced by Trp64ArgSNPβ3-AR detrusor cells in OAB group,wildβ3-AR detrusor cells and wildβ3-AR detrusor cells in control group,the results showed that the length diversity was highest in wildβ3-AR detrusor cells in control group,and the length diversity was lowest in Trp64ArgSNPβ3-AR detrusor cells in OAB group.Draw three length diversity curves according to different concentrations of BRL37344 and the difference was significant(P<0.001).Conclusion1.Trp64ArgSNP mutation rate in OAB group was higher.Functional impairment in relaxation of detrusor muscles was related toβ3-AR gene Trp64ArgSNP2.The tendency of BRL37344 concentration depended length diversity ascending inβ3-AR detrusor cells with Trp64ArgSNP mutation was lower than in wild typeβ3-AR detrusor cells in OAB group.Trp64ArgSNP mutation is a reason of poor efficacy when treated with adenorecepter agonist in some OAB patients. |