| Evidence has shown that estrogen plays a critical role during the onset and development of breast cancer. Exogenous estrogen might raise the risk of breast cancer. However, the roles of ERT (estrogen replaced treatment) in increasing risk of onset of breast cancer in women are yet unclear. Thus, it is important to observe the functions and the underlying mechanisms of estrogen in the onset and development of breast cancer.Estrogen is a liposoluble steroid hormone. The mechanism of its action can be classified in two pathways:genomic and non-genomic. In genomic action, estrogen can affect the transcription and translation of genes by activating nuclear estrogen receptors (ERa and ERβ). This action includes synthesis of protein which needs a long-term latency period. In non-genomic action, estrogen acts through the ERs located either in or adjacent to the plasma membrane, or through other non-ER plasma membrane-associated estrogen-binding proteins. The non-genomic effects occur within a few minutes. Further, studies have indicated that estrogen can affect tumor cells viability and metastasis by interacting with other receptors.ATP is not only a substance for applying energy, but also a transmitter between cells. It is implicated in wide biological effects by activating P2X receptors(ATP-gated ion channels) and P2Y receptors (G-protein coupled receptors). P2Y2 receptor is one type of eight subtypes of P2Y receptors(P2Y1.2.4.6.11-14) which have been cloned from human cells. To date, P2Y1, P2Y2 and P2Y11 have been implicated in many cancer tissues, including lung cancer, colorectal cancer and astrocytomas.It has been indicated that exogenous ATP can inhibit viability of cancer cells from the 80's of 20th century. Breast cancer cells can secret ATP/UTP, which also express P2Y2 receptor. The activated P2Y2 receptor plays multifunction in viability, differentiation, and apoptosis by activating PLC pathway, which increase levels of endogenous calcium. However, few report has been published on whether P2Y receptors play a role in development of breast cancer.It has been reported that the expression of P2X could be changed when the level of estrogen change in vivo, so it is possible that estrogen may regulate the expression of ATP receptors. However, few report has been published on whether estrogen can promote viability of breast cancer cells via modulating P2Y2 receptor.Therefore, in this report, we investigated the function of P2Y2 receptor in the breast cancer cell lines, MCF-7 and MDA-MB-231, and the involvement of P2Y2 receptors in the modulatory effect of estradiol in the breast cancer cell lines. We aimed at providing a novel clue to studying the mechanisms of estrogen on breast cancer which could be an experimental support for developing the novel anti-cancer drugs.1 Experimental Material and Methods1.1 Assessment of ViabilityThe MTT assays were conducted to assess cell viability. After incubation with drugs, cells seeded in 96-well plates were harvested and pre-incubated with MTT for 3-4 hours at 37℃. Discarded culture media, added 150μl DMSO, agitated cells on orbital shaker for 15min. Read absorbance at 490 nm.1.2 Assessment of ApoptosisFlow Cytometry was conducted to assess cell apoptosis. Cells were seeded in 12-well plates with the concentration of 1×105/well. After incubation with drugs, wash the cells in cold PBS. Cells were harvested after digested by 0.25% Trypsin(content with 1mM EDTA-4Na), and washed in PBS again.Then we centrifuged the washed cells at 800rad/min for 3min, discarded the supernatants and resuspended the cells in annexin-binding buffer. Added Alexa Fluor 488 annexin V and PI according to direction if the assay, incubated the cells protected from light, analyzed the stained cells by flow cytometry.1.3 The Reverse Transcription-Polymerase Chain Reaction Analysis (1) RNA isolation and complementary DNATotal RNA was extracted using a RNeasy Mini Kit(QIAGEN;CliftonHill, Australia).RNA purity was determined using a method of ultraviolet sepectrophotometry at a wavelength of 260-280 nm.2μg of total RNA was reversely transcribed to complementary DNA in a 25 ml reaction mixture containing 1×reverse transcriptase buffer(15nmol MgCl2,375mmol KCl,50mmol DTT,250mmol Tris-HCl pH8.3),10mmol dNTP,20U RNase inhibitor,200 U mol-MLV reverse transcriptase, and 50ng of oligo18 primer. The reaction time was at least 1h at 42℃. The cDNA was stored at -20℃until real-time reverse transcriptase-polymerase chain reaction(RT-PCR) was performed.(2) Real-Time RT PCRThe full cDNA sequences of rat P2Y2 were from GenBank(accession No. NM176072, NM001101 respectively) the following primers were used for PCR amplification:P2Y2, TGGCTCGGCGACTGCTAAA (sense), GCATCTCGGG CAAAGCGTA(antisense), The PCR conditions were 95℃for 5min, followed by 40 cycles of 95℃for 30sec,62℃for 25sec,72℃30sec;β-actin GTGTTGGCGTACAGGTCTTTG (sense), GGGAAATCGTGCGTGACATTAAG (antisense), The PCR conditions were 95℃for 5min, followed by 40 cycles of 95℃for 30sec,58℃for 25sec,72℃30sec. The PCR solution consisted of 1.2μl diluted cDNA,0.5μmol of each paired primers,1.6 mmol Mg2+,200μmol dNTPs,2U Taq DNA polymerase, and 1×PCR buffer.1.4 Western BlotCells were harvested and homogenized in cold lysis buffer (50 mM Tris-HCl, pH 7.4,150 mM NaCl,1% Triton X-100,1% Deoxycholic acidsodium salt,0.1% SDS,and a protease inhibitor mixture) using a homogenizer. Total protein concentration was determined by the Bradford method using bovine serum albumin as a standard. Proteins were separated using SDS-PAGE on 10%TRIS-HCl gels and electrophoretically transferred to polyvinylidene difluoride membranes. The membranes were blocked in blocking buffer consisting of 20mM Tris-HCl, pH 7.4,137mM NaCl,0.1% Tween 20, and 5% nonfat milk at room temperature for 2h and then incubated with the rabbit anti-human P2Y2 primary antibody(1:800), orβ-actin (1:800) overnight at 4℃.The blots were washed, incubated with HRP-conjugated secondary antibody(1:1000)for 2h at room temperature, and finally visualized in ECL solution for 1 min and exposed onto Kodak film for 1-5 min. As control of correct gel loading,β-actin quantification was used. To quantify Western blot signals, band density was measured using UMAX PowerLook III and normalized with respect to the control.1.5 Immunofluorescence MethodCells seeded glass slides were washed in 0.01M PBS for 3 times, immersed in 4% paraformaldehyde for 10min.Then the glass slides were washed in 0.01M PBS for 3 times, followed by incubation with ERα(1:50), ERβ(1:50) antibody overnight at 4℃.After washing with PBS, slides were incubated with Cy3-conjugated donkey anti-rabbit IgG at a dilution of 1:100 in PBS containing 1% NHS for 1 hour at room temperature. Finally slides were washed, covered and observed with NIKON fluorescence microscopy.2,Results2.1 The expression of ER(ERa and ERβ) and P2Y2 receptor in breast cancer cellsThe RT-PCR results showed that P2Y2 receptor is the only P2Y receptor expressed in MCF-7 cells, which is also expressed in MDA-MB-231 cells. Immunofluorescence method results showed, MCF-7 cells could express two kinds of ER receptor (ERa and ERβ), while MDA-MB-231 cells only expressed ER(3 receptor. ERαis negative in MDA-MB-231 cell line.2.2 Estrogen could promote viability and decrease apoptosis of MCF-7 cells through ER(1) The MTT results showed that the viability of MCF-7 cells were more than 130% of control after 48h in different concentration of 17β-E2 (0.01nmol/L-1μmol/L), respectively. The effect of 170-E2 on promoting viability of MCF-7 cells was time-dependant which reached to 486.3±7.88% of the initial value after 96h. The effect of 17β-E2 on promoting viability of MCF-7 cells could be blocked by the ER antagonist ICI 182,780.The flow cytometry (FCM) results showed that,48 hours after 17β-E2 (0.01nmol /L-1μmol/L) affecting, the apoptosis of MCF-7 cells were decreased significantly in 17β-E2 (0.01nmol/L～1μmol/L) groups compared with the control group, respectively. The effect of 17β-E2 on decreasing apoptosis of MCF-7 cells could be blocked by the ER antagonist ICI 182,780.(2) The MTT result showed that, after 72 hours in drugs, there was no significant difference between MDA-MB-231 cells in different E2 concentration and the control group. ICI 182,780 could not affect the viability of MDA-MB-231 cells after 72h in drugs as well. (3) The MTT result showed that, the viability of MCF-7 cells was 163.73±8.41% of control after 4 days in 17β-E2, and the difference was significant. The faciliation effect of 17P-E2 on MCF-7 cells could be blocked by the ERa antagonist MPP, but could not be affected by the ERβantagonist PHTPP.2.3 P2Y2 receptor was involved in the process of estrogen promoting viability of breast cancer cells.2.3.1 P2Y2 agonist UTP was involved in decreasing viability of breast cancer cells.The MTT results showed that, the viability of MCF-7 cells were 76.75±7.28% and 71.86±11.99% of the control respectively,, after 4 days in P2Y2 agonist UTP(10μmol/L,100μmol/L),which were significantly lower than the control group. The effect could be blocked by the P2Y specific antagonist suramin.The MTT results showed that, the viability of MDA-MB-231 cells were 84.35±2.29% and 81.20±5.13% of the control respectively, after 4 days in P2Y2 agonist UTP(10μmol/L,100μmol/L), which were significantly lower than the control. The effect could be blocked by the P2Y specific antagonist suramin.2.3.2 Suramin(P2Y antagonist) could enhance the facilitation of estrogen in MCF-7 cellsThe MTT results showed that the viability of MCF-7 cells was 187.94±22.71% and 182.35±22.64% of control after 4 days in 17β-E2 (0.1μmol/L) and P2Y antagonist suramin(10μmol/L,100μmol/L) co-application, respectively, which was increased significantly compared with that in the control group(P＜0.01) and the estrogen group(P<0.05).2.3.3 The effect of estrogen on regulating P2Y2 receptor expression in breast cancer cells(1) Estrogen inhibited expression of P2Y2 receptor via ERa in MCF-7 cells Real-time PCR showed that the expression of P2Y2 receptor mRNA was decreased after 24h in different concentration of 17β-E2. The effect is concentration-dependent. Western Blot showed that the protein expression was decreased in the same trend as mRNA. The inhibitory effect of 17β-E2 on expression of P2Y2 receptor in MCF-7 cells could be blocked by ER antagonist ICI 182,780.When MCF-7 cells were pre-incubated with ERα. antagonist MPP or ERβ. antagonist PHTPP respectively, the expression of P2Y2 mRNA is 112.64±14.35% and 97.44±8.24% of control. Both of them have no significant effect compared with control group(P>0.05, P>0.05). When MCF-7 cells were pre-incubated with 17β-E2the P2Y2 mRNA expression decreased to 56.5±6.01% of control. When MCF-7 cells were pre-incubated with MPP and 17β-E2 the expression of P2Y2 mRNA was 84.6±10.73% of control, which increased significantly compared with 17β-E2 group(P＜0.01). When MCF-7 cells were pre-incubated with PHTPP and17β-E2, the expression of P2Y2mRNA was 61.1±8.30% of control, which had no significant difference from that in 17β-E2 group (P>0.05).(2) Estrogen did not affect the expression of P2Y2 mRNA in MDA-MB-231 cells Real-time RT-PCR showed that, when MDA-MB-231 cells were pre-incubated with different concentration of 17β-E2, P2Y2 mRNA expression had no significant difference from that in the control group (P>0.05). When MDA-MB-231 cells were pre-incubated with 17β-E2 and ICI 182,780, the expression of P2Y2 mRNA had no significant difference from that either in the control group or in the 17β-E2 groups (P>0.05).3,Conclusion(1)Estrogen promotes proliferation and inhibits apoptosis of MCF-7 cells via activated estrogen receptor(ER); the faciliation of 17β-E2 in MCF-7 is mainly mediated by ERa.(2)UTP supresses the viability of breast cancer cells via P2Y2 receptor.(3)17p-E2 promotes the viability of breast cancer cells by downregulating expression of P2Y2 receptor mediated by ERa.In conclusion, estrogen might promote viability of breast cancer cells via activating ERa ..by downregulating P2Y2 expression and decreasing the inhibitory effect of P2Y2 on breast cancer cells. It is probably a novel pathway of estrogen effect on promoting the onset and development of breast cancer.
|
PDF Full Text Request