| Salmonella species are the major pathogenic bacteria of foodborne bacterial diseaseas in the worldwide. At present, the prominent problem is that Salmonella species is an important reason of food security and public health. Therefore, development of an accurate, rapid, real-time and high throughput identification method can significantly support thefood daily monitoring and Salmonella species outbreak investigation. This study is based on the DNA barcode theory and combines the pyrosequencing technique in order to identify Salmonella species.Four parts were included in this thesis:Firstly, Salmonella DNA barcode was preliminarily determined. invA, iroB, hns, hisJ, hilA, fimY gene which the most commonly used to identify Salmonella were selected from the sino-foreign literature. The six genes corresponding sequences were download in Genbank database and multiple sequence alignment determine the purpose fragments of each gene. The six specific PCR primer sets and sequencing primers were designed using Assay design software and preliminarily determined the DNA barcode.Secondly, Salmonella DNA barcode pyrosequencing method was established and Salmonella DNA barcode sequence was determined.Through optimizing the PCR amplification system and PCR reaction conditions and pyrosequencing conditions, the experiment maneuverability were enhanced. PCR mixture contained the following: 12.5μl 2×Go Taq Master Mix, 5pmol of each primer, 2μl of DNA template and added ddH2O until 25μl. The PCR reaction: after initial denaturation at 94°C for 5 min, 35 cycles of amplification included denaturation at 94°C for 20 s, annealing at 56°C for 30 s, and elongation at 72°C for 20 s. The reaction concluded with a 5 min extension phase at 72°C. 20μl of biotinylated PCR products and optimition of bases join procedure were used in the pyrosequencing system. 10 Salmonella strains and 10 non-Salmonella strains by prosequencing showed that only all of Salmonella strains obtained the correct DNA sequences. Some polymorphism sites were founded in the DNA sequence by online Blast tool analysis, but the base variation will not affect the accuracy of Salmonella detection.Thirdly, the new mthod were verified by a large number of known strains. 205 Salmonella strains and 60 non-Salmonella strains were identified by this newmethod, and the result showed that all Salmonella strains obtained DNA sequence which correspond with Salmonella DNA barcode. In non-Salmonella strains, only Shigella boydii DNA sequence was compatibile with the hilA DNA barcode of Salmonella. To avoid the false positive result, hilA gene was excluded in Salmonella identification barcode gene panel. Through a large number of strains further verified the accuracy and feasibility of this method. It indicated that pyrosequencing was a easy to operate, rapid, accurate, sensitive and high-throughput method. So the DNA barcode sequence to identify the Salmonella was determined in the study: (A)invA gene barcode:TGTTAATTGCGATTAGTGCCGGTTTTATCG;TGCTGATTGCGATTAGTGCCGGTTTTATCG;TGTTGATTGCGATTAGTGCCGGTTTTATCG;TGTTGATTGCTATTAGTGCCGGTTTTATCG;TGCTGATTGCGATTAGTGCTGGTTTTATCG;TGTTGATTGCCATTAGTGCTGGTTTTATCG.(B)iroB gene barcode:GGAGATAACCGGCTCTCCGTCATTTTGCAG;GGAGATAACCGGCTCTCCGTCATTTGGCAG.(C)hns gene barcode:AGTTGTCGTTAATGAGCGTCGTGAAGAAGA;AGTTGTCGTTAACGAGCGTCGTGAAGAAGA;AGTTGTTGTTAATGAGCGTCGTGAAGAAGA。(D)hisJ gene barcode:CTTCTCATCTTTCACCGCCGGGCCGCCGAA;GTTCTCATCTTTCACCGCCGGGCCGGCAAA;TTTCTCATCTTTTACCGCCGGGCCGGCAAA;CTTCTCATCTTTCACCACCGGGCCGCCGAA。(E)fimY gene barcode:TAGCGCAAGGCGCCTCTTTAAAAGAAA;TAGCGCAAGGTGCCTCTTTAAAAGAAA;TAGCACAAGGCGCCTCTTTAAAAGAAA。Finally, practical application of Salmonella DNA barcode pyrosequencing method.Through practical application which the food poisoning detection and food-borne disease monitoring, it showed that the result by Salmonella DNA barcode pyrosequencing method was same to the traditional cultural method (GB/T GB 4789.4-2008), and showed advantages of this method: efficiency, accuracy, real time. |