| Objective: Multiple myeloma is one kind of uncured hematopoietic malignant disease, the proteasome inhibitor bortezomib has shown obvious anti-tumor effect on multiple myeloma, and its overall reverse rate is 40%. Bortezomib combination with dexamethasone are more effective than bortezomib only. Valproic acid(VPA) is one kind of histone deacetylase inhibitor(HDACi). It has shown obvious anti-tumor effect on MM cell lines with less side effect. Pim-2 is one member of serine/threonine kinase family. It is a proto-oncogene which is correlated with maligant diseases. Pim-2 could be actived by several mitogenic signaling pathways, and lead hematopoietic cells canceration.Bcl-2 is recognized as a apoptosis inhibited gene,it plays an important role in the process of apoptosis and is the main factor which controlling the releasing of mitochondrial pro-apoptosis factors. Bax and Bcl-2 are both members of Bcl-2 protein family,Bax is a pro-apoptotic gene,Bax and Bcl-2 regulated cell apoptosis.We treated human IL-6-independent multiple myeloma cell lines PRMI8226 and IL-6 dependent multiple myeloma cell line U266 by bortezomib combinated with VPA, and observed the changes of the cells proliferation, cells apoptosis rate and pim-2,Bcl-2 and Bax gene expression to investigate the roles of bortezomib and VPA,and hope to provide theoretical basis for the new regiman.Methods:1 Cultivation Human MM Cell LinesHuman MM cell lines RPMI8226 and U266 were cultured in RPMI1640 medium, supplemented with 20% (v:v) fetal bovine serum, 100U/ml penicillin G and 100μg/ml streptomycin sulfate, at 37℃in an atmosphere of 5% CO2. The cells were half passaged every two or three days. Logarithmic growth cells were used in the experiment. 2 MTT MethodRPMI8226 and U266 cells in logarithmic growth state were planted in 96-well plates in RPMI1640 medium, with 180μl cell suspension in each well with different drug concentration.One hole without drug as control and every well had another four same wells.Drug concentration of bortezomib was chosen as 0.1×10-6mol/l based on MTT pre-test,and Drug concentration of VPA was chosen as 2,16,32mmol/l based on MTT pre-test. Cultured with different concentrations of RPMI8226 with drugs for 12h,24h,36h and U266 for 24h,36h,48h. Then cells were harvested, detected the proliferation in MM lines by MTT after the drug intervention.Grouping as follows: A/A':controls;B/B':BZ 0.1×10-6mol/l;C/C':BZ 0.1×10-6mol/l+VPA 2mmol/l;D/D':BZ 0.1×10-6mol/l+VPA 16mmol/l;E/E':BZ 0.1×10-6mol/l+VPA 32mmol/l。Proliferation detected by MTT. OD570nm detected by ELISA analyzer.Inhibation rate=[(controls OD-test group OD)/controls OD]×100%3 AnnexinV/PI MethodRPMI8226 cells in logarithmic growth state were planted in 12-well plates and U266 cells in 24-well plates at density of 2-5×105 cells/ml in RPMI1640 medium. Different concentrations of bortezomib combination with VPA cultured with RPMI8226 and U266 cells. Flow cytometric detected apoptosis by the way of AnnexinV/PI at different times.4 RT-PCR for Bcl-2 and Bax mRNA.Extract total RNA from RPMI8226 and U266 cells treated with different density of drugs. Detect the total RNA of OD260, concentration and OD260/OD280. Using the method of semi-quantitative polymerase chain reaction to detect the expression of Bax and Bcl-2 gene.Primers as follows: Bcl-2,F:5′-GACTTCGCCGAGATGTCCAGC-3′,R:5′-GCATCCCAGCCTCCGTTATCC-3′,Bax F:5'- TTTGCTTCAGGGTTTCATCCAGG -3',R:5'- GAGCTCCATGTTACTGTCCAGTTCG-3' ,β-actin: F 5'- GTGACATTAAGGAGAAGCTG-3'R:5'-CTAGAAGCATTTGCGGTGGAC-3'.The amplification mixture comprised of 50ng RNA, 1.5μmol each of the forward and reverse primers, GoTaqR Green Master Mix,2X 12.5μl, Nuclease-Free Water 7.5μl。in a total volume of 25μl. The cycling condition of Pim-2 was initially denatured at 95°C for 3 minutes, followed by 40 cycles of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 1 min, and a final extension at 72°C for 5 minutes. The cycling condition of Bcl-2 was initially denatured at 95°C for 3 minutes, followed by 40 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1 min, and a final extension at 72°C for 5 minutes. semi-quantited by AlphaImager1200 imaging system and Gel-pro software.5 RT-PCR for Pim-2Primers for Pim-2 are as follows: F: 5′-CAGCCATCCAGCACTGCCATTC-3′, R: 5′-AG TCTGGGGAGACATGGGCTGG-3′.6 Statistical AnalysisThe software of SPSS 17.0 (SPSS Inc., USA) was used. Mean士standard deviation expresses grouped data. One-way analysis of variance(ANOVA) was used for comparing means. P <0.05 was indicated statistical significance.Results:1 Proliferation of MM Cell Line RPMI8226 Treated with Different Density of DrugsBZ and VPA: The inhibition rate of RPMI8226 increased with the elevation of VPA concentration. Only using bortezomib, the inhibition rate of RPMI8226 increased apparently at the concentration of bortezomib over 0.01×10-6mol/l.Inhibation rate of RPMI8226 cells treated with BZ and VPA 12h increased obviously from B to E group(P=0.000).24h, B 0.2808±0.0273,C 0.4109±0.0363,D 0.4504±0.0581,E 0.5142±0.0137,36h,(P=0.047).Inhibation rate of RPMI8226 increased as dose dependent..Inhabition rate at 12h,24h,36h are significantly different. The inhibition effect of combinated drugs with VPA and bortezomib is more significantly than single drug with VPA or bortezomib, and increased with the elevation of VPA concentration and the extension of time. the maximum inhibition of cell growth inhibition rate was 0.5142± 0.0137 at 36h.2 Proliferation of MM Cell Line U266 Treated with Different Density of DrugsWith VPA only:the inhibition rate of U266 increased with the elevation of VPA concentration. With bortezomib only, the inhibition rate of U266 increased apparently at the concentration of bortezomib over 0.1×10-6mol/l. The inhibition effect of combinated drugs with VPA and bortezomib is more significantly than single drug with VPA or bortezomib, and increased with the elevation of VPA concentration and the extension of time(P<0.01).Also,it was found that it was not singnifigantly different between 1mmol/l VPA with bortezomib and bortezomib only(P=0.356).3 Detected Apoptosis by the way of AnnexinV/PI MethodInhibation rate of RPMI8226 cells treated with BZ and VPA are as follows:12h, A26.6000±1.1000,B25.1667±3.5232,C33.0333±2.4583,D37.8333±0.6110,E41.4000±1.0392; 24h,A36.2333±3.1628,B39.8000±0.4358,C47.1666±2.2810,D50.5333±1.6258,E52.0333±1.4640;36h, A54.0666±3.4122,B 61.8333±1.2741,C 64.4000±1.2124,D 66.2000±0.9539,E 68.5000±1.0392,Inhibation rate of U266 cells treated with BZ and VPA are as follows:12h:A'24.0333±2.5658, B'24.4666±1.2741, C'26.1000±1.05356, D'32.1000±1.2165,E'32.7333±0.6429;24h: A'22.3000±0.8000,B'24.2666±1.1150,C'34.3333±1.2662,D'47.4666±0.9073,E'54.6000±1.05366;48h:A'23.2666±1.4011,B'25.0666±2.4172,C'49.3000±0.5196,D'63.0333±1.3868,E'65.4000±1.0817,VPA combination with bortezomib could induce apoptosis of RPMI8226 and U266 cells , and the effect was related to the drugs concentration and the extension of time .With the extension of time, early apoptosis cells inceased in U266 cells,and with the extension of concentration ,advanced apoptosis rate increased. Different apoptosis rate between groups suggesting that BZ combined VPA on U266 cells apoptosis was significantly higher than RPMI8226 cells (P = 0.003).4 Detect the Expression of Bcl-2 and Bax Gene in MM Cell LinesBcl-2 mRNA expressed positive in both RPMI8226 and U266 cells, With the extension of drug concentration, Bcl-2 mRNA expressing level inceased(P<0.05).RPMI8226 cells 24h Bcl-2 mRNA express level are as follows: A 1.280±0.160;B 0.607±0.035;C 0.410±0.105;D 0.355±0.029;E 0.275±0.400. U266 cells 24h Bcl-2 mRNA express level are as follows: A'0.656±0.013;B'0.543±0.025;C'0.437±0.121;D'0.259±.070;E'0.136±0.197. U266 cells 24h Bax mRNA express level are as follows: A'0.573±0.011;B'0.656±0.032;C'0.146±0.007;D'0.089±0.017;E'0.123±0.006.5 Detect the Expression of Pim-2 Gene in MM Cell LinesPim-2 mRNA expressed positive in healthy control peripheral blood monocellular cells. It's also expressed positive in U266 cells, has not statistical significance between different drug densities and healthy control(P=0.447). Pim-2 mRNA level is not correlated with different drug densities in U266 cells. Pim-2 mRNA expressed negative in RPMI8226 cells.Conclusions:1 Bortezomib combination with VPA can inhibit RPMI8226 and U266 cells proliferation and induse cells apoptosis. It's more significant than single drug of bortezomib. Induced cells apoptosis presente dose dependent and time dependent relationship.2 Bortezomib combination with VPA can inhibit IL-6 dependent MM cell line U266 rather than IL-6-independent MM cell lines PRMI82263 Bcl-2 mRNA expressed positive in both RPMI8226 and U266 cells, With the extension of drug concentration, Bcl-2 mRNA expressing level inceased.In U266 cells ,Bax mRNA expressing level is not decreased singnifacantly while drug concentration extended.4 Pim-2 mRNA express positive in U266 cells, and Pim-2 mRNA express negative in RPMI8226 cells.it has no statistical significance with healthy control, and is not correlated with drug densities. |