ShRNA Targeted At Glycosyltransferases Inhibit Proliferation And Migration Of Liver Cancer HepG2 Cell Line In Vitro And In Vivo

Background:Glycoprotein is widely present in the cell membrane and intercellular substance, composed by oligosaccharide and protein, in which, oligosaccharide is almost more important than protein. Oligosaccharide plays a key role in the process of cell recognition and signal transduction. Structural changes in N-glycans are one of the critical steps in cellular malignant transformation. As we all know, the structure of an abnormal increase of glycoprotein is always found in tumor cells, which is closely related to tumor proliferation, migration and metastasis. Glycosyltransferase activation is a major mechanism.N-acetylglucosaminyltransferase V, one of the key enzyme for glycoprotein synthesis, has become another hot spot in Cancer research. GnT-V catalyzes the formation of GlcNAc-β1-6 branches at the Man a 1-6 side of the trimannosyl core of N-glycans. GlcNAc-β1-6 branches of tumor cell surface promotes its invasion of basement membrane, which is always found in the breast cancer and colon cancer.RNA interference (RNAi) refers to the introduction of homologous double stranded RNA (dsRNA) to specifically target a gene's product, resulting in null or hypomorphic phenotypes. This method is efficient,stable and specific.By RNA interference technology, small haired RNA targeting at N-acetylglucosaminyltransferase Vgene was transfected into the hepatoma cells. To study the effects of GnT-V shRNA on proliferation and migration of the hepatoma cells,we adopt a number of ways, which is responsible for Liver cancer molecular targeted therapyObjective:To transfect vectors of small haired RNA targeting at GnT-V gene into the Liver cells and investigate the effects of GnT-V shRNA on proliferation and migration of the Liver cells, which is helpful to identify new target in molecule-targeting treatment of liver cancer.Methods:1,The construction and identification of pGPU6/GFP/Neo GnT-V shRNA has been finished by HE Fuli,one member of our team.a. GnT-V siRNA sequence design:According to siRNA design principle, using "siRNA Target Finder and Design Tools" of Ambion company, we designed two RNA fragments aiming at GnT-VcDNA(NM₀02410.3). sequence information as follows:sense 5' GGAAGTGCATGCAACTGTTTA 3', sense 5' CTCCTTT GACCCTAAGAAT 3', naming them GnT-V/1564 and GnT-V/2224 respectively. To design a negative control siRNA, scramble the nucleotide sequence of the gene-specific siRNA and conduct a Blast contrast to make sure it lacks more than 70 % homology to any other gene. Negative control sequence information as follows: sense 5' GTTCTCCGAACGTGTCACGT 3', naming it GnT-V/NC.b. shRNA transcriptional template DNA design:According to designed siRNA sequence, we designed template DNA oligonucleotides, the order of sequence as follows:Bbsâ… restriction site, sense sequence,9nt loop sequence, antisense sequence, RNA polymeraseâ…¢termination(6 nucleotide poly T), BamHâ… restriction site.c. Construction and identification of pGPU6/GFP/Neo GnT-V plasmid:To construct recombinant plasmid, we annealed the two siRNA template oligonucleotides of each group, and ligated annealed siRNA template insert into pGPU6/GFP/Neo, then transformed E. coli DH5αwith the recombinant plasmid, picked Kanamycin resistant colonies and isolated plasmid DNA, digested the plasmid with Bbsâ… and BamHâ… , sequenced with U6 primers to verify that the clone contains the insert, and that it is the desired sequence. Then expanded colonies, extracted and purified pGPU6/GFP/Neo GnT-V plasmid for transfection.2,Cell cultureHuman liver cancer cell line HepG2 was cultured in RPMI-1640 containing 10% newborn cow serum, in the condition of 37℃5% CO2. When liver cancer cells were cultured to exponential growth phase, Lipofectamine 2000TM was used to transfect recombinant plasmids into HepG2 cells. Stable transfectants were selected in RPMI-1640 containing G418 at 500μg/mL.3,Cell transfectionWhen liver cancer cells were cultured to exponential growth phase, Lipofectamine 2000TM was used to transfect recombinant plasmids into HepG2 cells. Stable transfectants were selected in RPMI-1640 containing G418 at 500μg/mL4,Examination of interfered effectsa. The mRNA expression of GnT-V were measured by semi-quantitative reverse transcription polymerase chain reaction(RT-PCR). Total RNA was isolated from cells and converted into cDNA by using hexamer random primers. N-Acetylglucosaminyltransferase V cDNA was amplified by using the primers 5' AACTCTTGGACCATCCTGGGTTC 3'and 5' TTGCTGCTTTTGGGTGGGTT 3 ', which generated 555bp products. To normalize the efficiency of the amplification,β-actin cDNA was amplified by using the primers 5' GAAACTACCTTCAA CTCCATC 3'and 5' CGAGGCCAGGATGGAGCCGCC 3', which generated 219bp products.They were amplified by 36 cycles of 94℃for 30 s,60℃for 30 s and 72℃for 30s.b. The protein expression of GnT-V were measured by Western blot analysis. Proteins were resolved on SDS-PAGE and transferred to Immobilon polyvinyldifluoride (PVDF) membranes. The blots were blocked with 5% defatted milk for 1h at room temperature and then probed with goat anti-human antibodies against GnT-V(1:200) and mouse anti-human antibodies against GAPDH(1:1000) for 1h at room temperature, respectively. After three washes, the blots were subsequently incubated with rabbit anti-goat peroxidase-conjugated secondary antibody(1:500) and rabbit anti-mouse peroxidase-conjugated secondary antibody (1:5000) for 1h at room temperature, respectively. The blots were visualized by enhanced chemiluminescence using Fuji super RX film (Fuji film, Tokyo, Japan).5,The effects of pGPU6/GFP/Neo GnT-V shRNA vectors on proliferation of HepG2 cell lineCell proliferation was evaluated by CCK-8 assay:Cells were cultured to exponential growth phase, CCK-8 assay was used to analyze cell activity at different times(0h,24h,48h,72h,96h), six replicates were measured at each time. Cell growth curves were portrayed by using OD450nm value of each group, and calculated growth inhibitory rate of interfered group. Cell growth inhibitory rate(IR)=(OD450 value of negative control group -OD450 value of interfered group)/OD450 value of negative control group×100%.6,The effects of pGPU6/GFP/Neo GnT-V shRNA vectors on migration of HepG2 cell linea. Chemotactic migrationThe inhibitory effect of RNAi on migration and invasion of HepG2 cells in vitro was assayed using 24-well Transwell cell culture chambers(6.5 mm diameter,8.0μm pore size, polycarbonate membrane, Corning). Cells were cultured in the absence of newborn cow serum for 24 hours.10% newborn cow serum was chosen as chemotactic factor. Results are shown as the number of cells that had migrated through the polycarbonate membranes by counting 5 randomly chosen HPF under light microscopy(400×) for each replicate.b. Wound closure assayCells of exponential growth phase were plated onto Collagenâ…£coated wells, and were cultured to grow to monolayer. Linear scrape wounds were made on the cell monolayers, and cultured in the presence of 10% newborn cow serum. The wounds were allowed to heal for 36 hours. Pictures of wound heal were taken in 4 randomly chosen HPF under light microscopy for each replicate at 0h,12h,24h and 36h respectively(240×), wound cure rate=(distance of linear scrape wounds before healing-distance of linear scrape wounds after healing)/distance of linear scrape wounds before healing×100%.7,Tumorigenicity in nude miceThe experimental protocol was approved by the China Institutional Ethics Review Committee for Animal Experimentation. Cells (2.5×106/mouse) suspended in 100μL RPMI-1640 were injected subcutaneously into the 6-week-old male BALB/c nude mice at the hips. The animals were sacrificed on the 21st day after injection and the tumors were dissected and weighed.8,StatisticsResults were analyzed by SPSS13.0 software. The values given are means±SD. Statistical analysis between two samples was performed using Student's t-test. Statistical comparisons of more than two groups were performed using one-way analysis of variance (ANOVA). In all cases, p< 0.05 was considered as significant.Results:1,Stable transfection of recombinant plasmid Plasmid pGPU6/GFP/Neo contains the coding sequence of Green Fluorescent Protein gene, so stably transfected cells can emit green fluorescence by fluorescence microscopy. Fluorescence microscopy detection showed that recombinant plasmids were stably transfected to HepG2 cell line successfully.2,Examination of interfered effectsThe mRNA expression of GnT-V in three cell groups were evaluated by semi-quantitative RT-PCR. GnT-V shRNA can reduce expression of GnT-V mRNA in HepG2 GnT-V/1564 cells and HepG2 GnT-V/2224 cells, by 83% and 61% respectively. The protein expression of GnT-V in three cell groups were analyzed by immunoblotting with anti-GnT-V antibody. GnT-V shRNA can down-regulate GnT-V protein expression of HepG2 GnT-V/1564 cells and HepG2 GnT-V/2224 cells, by 71% and 54% respectively. The more effective interfered cell line, HepG2 GnT-V/1564, was chosen to do further experiment.3,Influence of GnT-V shRNA expression vectors on cell proliferationCell growth curves were portrayed by using OD450nm value of different times(0h,24h,48h,72h,96h), and calculated growth inhibitory rate of HepG2 GnT-V/1564. CCK-8 assay showed proliferation of HepG2 GnT-V/1564 was inhibited obviously (P<0.001).4,Influence of GnT-V shRNA expression vectors on migrationDown-regulation of GnT-V expression can inhibit chemotactic migration in HepG2 cell line; quantitative analysis of the wound closure assay also indicated that down-regulation of GnT-V expression can significantly prolong wound heal hours of HepG2 cell line;5,Influence of GnT-V shRNA expression vectors on cell proliferation in vivoMean weight of HepG2 GnT-V/NC and HepG2 GnT-V/1564 were (1.72+ 0.36)g and (1.00±0.39)g respectively, down-regulation of GnT-V expression can reduce cell proliferation of HepG2 cell line in vivo(t=3.308, P=0.008). Conclusion:1,The shRNA expression vectors targeting at GnT-V gene can down-regulate the expression of GnT-V both in the level of mRNA and protein obviously.2,Down-regulation of GnT-V expression can significantly inhibit proliferation of HepG2 cell line in vitro.3,Down-regulation of GnT-V expression can significantly inhibit proliferation of HepG2cell line in vivo.4,The sequence of RNA interference against GnT-V may be a valid target to treat liver cancer.