Detection Of Human Astrovirus Type 1 By Loop-mediated Isothermal Amplification

BackroundHuman Astrovirus (HAstV) was discovered for the first time in 1975 by Appleton and Higgins when they were using electron microscope for the detection stool samples of children with gastroenteritis. Astrovirus is a non-capsid single-strand sensitive RNA virus and a family of Astroviridae and Astrovirus. The diameter of the viral particle is 28nm, which shows a shape of star under electron microscope, therefore, the virus was named as astrovirus by Madeley and Cosgrove. The viral genome is 618 kb in length, containing three open reading frames:ORFla, ORFlb, ORF2. ORF1a and ORF1b are at the 5'end, which are highly conserved regions, mainly encoding the protease and RNA polysaccharide; ORF2 is at the 3'end with a length of 2388 kb, which is a ever-changing area, mainly encoding the capsid protein. In addition, the genome also includes a 5'non-coding region, a 3'non-coding region and an approximately 30-nucleotide poly-nucleotide tail.HAstV is one of the most important pathogens that cause diarrhea in infants, as it was proved that astrovirus closely related to diarrhea by the study of volunteers and natural infection. Astrovirus infection was reported around the world, which could be found separately or in an epidemic outbreak and also in iatrogenic infections. Astrovirus infection occurs in infants less than 2 years of age, especially infants less than 1 year of age, which is similar to rotavirus. With a detection rate from 2.5% to 9.0% in hospitalized children with diarrhea, astrovirus is now considered as the second cause of viral gastroenteritis in infants and young children, second only to rotavirus. In addition, the elderly and patients with immunodeficiency are also at high risk. Astrovirus infection was reported in human immunodeficiency virus infection, bone marrow transplantation and combined immunodeficiency patients. Astrovirus is also one of the causes of gastroenteritis occurred in healthy adults.With the application of polyclonal antibodies and monoclonal antibodies, astrovirus can be divided into eight serotypes. Astrovirus widely distributed around the world and the prevalence of its serotypes varies in regions and years, mostly dominated by serotype 1. With an apparent seasonality, astrovirus infection generally occurs in the temperate regions in winter, compared with the tropical regions in rainy season. Serum epidemiological studies have shown a positive rate of 90% of IgG antibody for serotype-1 astrovirus in 5-year-olds, indicating that children have had extensive contacts with astrovirus before the age of five. Afterwards people have isolated astrovirus from the cats, sheep, pigs and other animal feces, and mud, the lake water. It has been reported Miossee isolated astrovirus from the aquatic crustacean, suggesting that astrovirus may be the same as the hepatitis A virus spreading through the aquatic crustaceans. To detect astrovirus simply and quickly has been one subject of study.Now commonly used detection methods are as follows:1. Electron microscopy. Appleton, etc. discovered astrovirus with electron microscope for the first time in 1975, and since then in more than ten years, the electron microscopy was the primary means for the detection of astrovirus. It is visualized and intuitive by this method, however, only 10% of astrovirus has a typical star-shaped appearance and therefore it is less sensitive. Adding fluorescent labeled antibodies to samples can improve detection rate, which is known as immune electron microscopy. However, when the virus titer is low, there is still a high false negative, and it is expensive, demanding better technical conditions, so it is not suitable for large-scale epidemiological investigations.2. Cell culture and virus separation. In 1977, Lee and Kurtz successfully separated astro virus by using human embryonic kidney cell. In 1990, Willcocks, etc. directly isolated astrovirus from the diarrhea samples by using cell lines with passage of human colon cancer cells (CaCo-2) and astrovirus proliferated well in CaCo-2 cell, which made great progress in astrovirus detection methods. People could make use of the proliferated virus to produce monoclonal antibodies of different serotypes, and monoclonal antibodies laid the foundation for the subsequent enzyme-linked immunosorbent method applying for a large number of epidemiological investigations, and as such, gradually diarrhea caused by astrovirus was known and gained attention.3. Enzyme immunoassay (EIA) and enzyme-linked immunosorbent assay (ELISA):Based on the successful preparation of monoclonal antibodies of astrovirus, Herrmand, etc. developed the method of EIA and ELISA, which was simpler with better sensitivity and specificity and could carry out genotyping. However, because monoclonal antibodies for the detection in the business were often difficult to obtain and expensive, there was great difficulty for conventional application at present.4. Reverse transcription-polymerase chain reaction (RT-PCR). With the success of the cultivation, separation and sequencing of astrovirus, RT-PCR assay also emerged. Beginning in 1993, RT-PCR assay was applied for the detection of astrovirus, and a comparison with the EIA found that RT-PCR assay had higher sensitivity and specificity than the EIA getting rid of restrictions of serum antibodies that were difficult to obtain. Therefore, at present this method was used in most reported studies of astrovirus.5. Serological tests. Serological detection methods of astrovirus include immuno-electron microscopy (IEM), radioimmunoassay (RIA), immunofluorescence assay (IFA), enzyme immunoassay (EIA) and so on. Serological detection methods may help to know astrovirus infection, and because specific antibodies of astrovirus were now considered to only have some protective effect, it was seldom carried out.Loop-mediated isothermal amplification (LAMP) is a new type of nucleic acid amplification method developed in 2000 by Notomi, etc. of Eiken Chemical Co., Ltd., in Japan. The reaction principle of LAMP is to make use of Bst large fragment DNA polymerase, inner primers (FIP formed by F1c and F2; BIP formed by B1c and B2) and outer primers (F3 and B3) which are designed according to different target sequences and specifically identify target sequences on the six separate regions, through the strand displacement cycling reaction in the constant temperature raging from 60 to 65 centi-degree, to generate DNA product containing a number of alternative repetitive stem-loop structure.The enzyme reaction system is used in LAMP, directly amplifying the target nucleic acid sequence, enabling the exponential amplification of the target nucleic acid sequence that reaches 109 to 1010 order of magnitude in 45 to 60 minutes; during the reaction process it is no need to control the temperature changes for the reaction can be carried out by heating with constant temperature in water bath, eliminating the costs for expensive thermal cycler. As amplification proceeds only when two pairs of primers exactly match the six different regions on target gene, LAMP has a high specificity. In DNA synthesis, the pyrophosphate ions separated from deoxynucleic acid triphosphate substrate (dNTPs) react with the magnesium ions in the reaction solution, producing a large number of white precipitate of magnesium pyrophosphate. Therefore, turbidity can be used as reaction indicator, as observing a white cloudy precipitate only by the naked eyes will be able to identify whether the amplification occurs or not, without the need for tedious agarose gel electrophoresis and observation under UV. Sometimes, there may be some errors to judge by observing a white precipitate with the naked eyes. The Eiken Chemical Co., Ltd. made use of the white precipitate of magnesium pyrophosphate produced in LAMP reaction and developed a real-time turbidimeter specially for the detection of LAMP reaction, in order to accomplish amplification and detection of LAMP simultaneously with real-time monitoring during the process. In addition, it is also useful to add fluorescent dye, such as ethidium bromide (EB), SYBR GreenⅠdye etc., to detect amplification. The final product of LAMP reaction is composed of a mixture of stem-loop DNA in different sizes, and in 2% agarose gel electrophoresis shows a typical DNA ladder. Since LAMP has many advantages such as being easy to perform with high specificity and being simple to determine the result, once this method is available it has been applied for the many aspects, including detection of pathogenic micro organisms in human, animal and plant, identification of gender of animal embryos and detection of genetically modified food.ObjectiveTo establish a loop-mediated isothermal amplification method for rapid detection of human astrovirus of serotype 1.Methods1. Collection of samplesOne stool sample positive for HAstV genotype 1 and one for sapovirus genotypeⅡwere obtained from institute of viral disease control and prevention, Chinese center for disease control and prevention. Two stool samples positive for norovirus genotyopeⅡand three for rotavirus group A were preserved in the lab. Eighty stool samples from patients with nonbacterial diarrhea were collected from August 2006 to January 2007 in pediatric clinic of Jiangmen maternal and child health hospital and emergency department and diarrhea clinic of Jiangmen people's hospital. Stool samples were preserved as suspensions with PBS of PH7.2 under-40 centi-degree.2. Primer designTargeting at the conserved region of ORF1a on the genome encoding the non-structural protein, the target sequence of LAMP was identified with alignment of sequences of HAstV ORFla published on the GeneBank using the software ClustalW2. Specific RT-LAMP primers was designed by entering the target sequence into the online software Primer Explorer V4, and the nucleic acid sequences of primers (from 5'to 3') were as follows:F3:GCATTATCTTCTTGTGCTTCA; B3:TCACGGATCTCGAACCTG;FIP:CCACCAGCAATTAATACTGCTGTAGGAAGACTCCAACTATGTGAGC;BIP:GCACGACCACGTCATTGTTTCAATGAAAACAGTTGCCATAC.3. RNA preparationRNA was extracted from stool specimens collected by the Trizol method and dissolved in DEPC treated water, with the OD values at 230 nm,260 nm,280 nm and 310 nm determined and kept at-80 centi-degree until used.4. Optimization of RT-LAMP reaction condition and detection and digestion of RT-LAMP productThe reactions were completed at a constant temperature of 60 centi-degree within a duration of 45,60,75 and 90 minutes, respectively, with a final incubation at 80 centi-degree for 5'minutes to inactivate enzymes and terminate the reaction. Products can be observed under ultraviolet light by gel electrophoresis and ethidium bromide staining, and with the naked eye after the fluorescent dye SYBR Green I staining. RT-LAMP products were purified using a gel extraction kit. After the product was digested by the restriction enzyme Taal, fragments produced by digestion could be detected by agarose gel electrophoresis.5. Detection specificity and sensitivity of HAstV-1 in stool samples by RT-PCR and RT-LAMP5.1 The outer RT-LAMP primers F3 and B3 was used as the forward and backward primers for RT-PCR amplification. RT-PCR products were purified using a gel extraction kit and ligated into plasmid pMD18-T vector and the recombinant plasmid was transformed into Escherichia coli strain DH5a. By blue-white colony selection the white colonies were picked for amplification with shaking in LB broth medium containing ampicillin. The plasmid was extracted as template for PCR by F3 and B3 primers set to identify the correct clone. The OD values of plasmid solution at 230 nm, 260 nm,280 nm and 310 nm were determined and plasmid solution with a concentration of 2.3×108copies/μl were kept at-20 centi-degree until used.5.2 One stool sample positive for HAstV-1, one for sapovirus GII, two for norovirus GII and three for rotavirus group A were detected by RT-LAMP and RT-PCR after RNA extraction.5.3 The stock solution of RNA extracted from positive sample of HAstV-1 was 10-fold serially diluted and the concentrations were 1ng/μl, 100pg/μl, 10pg/μl, 1pg/μl, 100fg/μl and 10fg/μl. RT-LAMP and RT-PCR were used for the detection.5.4 The stock solution of recombinant plasmid was 10-fold serially diluted from 2.3×107 copies/μl to 23 copies/μl. LAMP and PCR were used for the detection.6. Evaluation of RT-LAMP and RT-PCR using clinical samplesAfter RNA extraction 80 stool samples collected from patients with non-bacterial diarrhea were detected by RT-LAMP and RT-PCR.Results1. In different reaction time the RT-LAMP products showed the characteristic ladders by agarose gel electrophoresis, with the most apparent ladders observed in 90 minutes which was considered to be the optimal reaction time.2. By adding fluorescent dye into RT-LAMP products, the reaction solution turns green, showing the positive result while negative control and no template control keep the color of orange, showing the negative results.3. After digestion by the restriction enzyme Taal, it showed that fragments produced by digestion have the expected sizes (206,225,244 bp).4. RT-LAMP and RT-PCR were used to detect HAstV-1 and positive results were showed, while other viral strains were negative.5. The lower limit of RT-LAMP for the detection of HAstV-1 RNA was 5 pg per reaction and the lower limit of LAMP for the detection of recombinant plasmid was 230 copies perreaction while RT-PCR and PCR was 50 pg per reaction and 2.3×103 copies per reaction, respectively.6. RT-LAMP and RT-PCR were used to detect 80 stool specimens collected from patients with diarrhea, of which three were positive and the rest were all negative. The test results of two methods were consistent.ConclusionThe RT-LAMP assay established in this study, with high specificity and sensitivity for the detection of HAstV-1 and less time cost, was practical and suitable for primary laboratory and field applications.