| Objectives:To construct RNA interference eukaryotic expression vectors targeted at STAT5A gene.To investigate the effects of inhibition of STAT5A gene expression in human hepatocellular carcinoma cell line HEPG-2 by RNA interference technology,and growth inhibiting condition.This research can provide a new approach to the gene therapy of hepatocellular carcinoma.Methods:Designed RNA interference target sequence targeted at STAT5A gene GCTCTGAATTAGTCCTTGCTT and GCGCTTTAGTGACTCAGAAAT, then synthesize two strands of oligonucleotides including a hairpin structure,then the double-strand DNA was inserted downstream from the U6 promoter of the linear pYr-2.1-hU6 vector by T4 DNA ligase and the recombination expression plasmid pYr-2.1-STAT5A-shRNA-1 and pYr-2.1-STAT5A-shRNA-1 were constructed.The next step was transfecting the recombinant into the susceptible cell E.coli DH5a which was prepared by CaCl2 method, and choosing the positive colony which was screened by kanamycin resistance and CCDB to amplify by shaking, then extracting the plasmid.To make sure the interference fragment was accurate, that is to say, the RNAi expression vector targeting STAT5A had been constructed successfully, the extracted recombinant was digested by XhoI respectively,and to analyze the result by agarose electrophoresis and DNA sequencing. At the same time,constructed the negative control pYr-2.1-HK that did not aim at any gene.We used pYr-2.1-EGFP that for transfection rate,HEPG-2 cells that were in good condition were plated in 6-well cell culture plates,then we added 7.5μl LipofectamineTM2000+ 3μg plasmid(pYr-2.1-EGFP)/well,and then transfected the compound to the HEPG-2 cells,At 48 hours post transfection,the EGFP(green fluorescent protein) gene of recombinant could express,so transfection rate could be judged by observing the ratio of green fluorescence cells under the fluorescence microscope.Then set up four experimental groups, they were blank control group, HK group, STAT5A-1 group, STAT5A-2 group.We also added 7.5μl LipofectamineTM2000+3μg plasmid/well,and then transfected the compound to the HEPG-2 cells (do not add any reagent to blank control group). At 48 hours after transfection, the total protein from each well of cells was isolated for Western blot to detect the relative expression of STAT5A protein in every group.At the same time, at 1~4d after transfection, the inhibition effects of the cell growth were detected by MTT assay.Results:l.The recombinant plasmids pYr-2.1-STAT5-shRNA-1和pYr-2.1-STAT5-ShRNA-2 were digested with Xhol to agarose gelelectrophoresis and sequence analysis,showed that the target sequence had inserted into the predicted site precisely and the recombining plasmids were successfully constructed.2.Observe the HEPG-2 cells under the fluorescence microscope 48h after transfection, and judge the transfection rate that LipofectamineTM 2000 to HEPG-2 cells was above 65% according to the ratio of the cells shinning green fluorescence.3.The result of the western blot showed that the lightness of the strips of GAPDH (37KD) in the four channels were similar, while the luminosity of STAT5 strip (94KD) were obviously weaker in the STAT5A-1 group,STAT5A-2 group when compared with the other two groups.And the result of the semi-quantitative gray scale scan showed that the relative expression quantities of STAT5 protein in STAT5A-1 group,STAT5A-2 group,blank control group and negative control group were 0.362±0.006,0.485±0.004,1.266±0.004,1.267±0.005.These data were analyzed by q test of ANOVA that the relative expression of STAT5 protein of STAT5A-1 group,STAT5A-2 group was about 71.4% and 61.7% lower than the others groups,and the difference had statistical significance (P<0.05).But the comparation among the other two groups had no significant difference (P>0.05).4.The result of analysis of MTT showed that STAT5A-1 group,STAT5A-2 group HEPG-2 cells growth velocity were step down,the proliferation inhibition rate were inhibited significantly,and the inhibition ratio both to reach the peak at the second and third day,is 50%,44.3%,had statistical significance (P<0.05);but the difference between the blank control group and HK group had no statistical significance (P>0.05).Conclusions:1.The shRNA interference sequence that had designed and synthesized had cloned to pYr-2.1-hU6 expression vector accurately,RNA interference eukaryotic expression vectors targeted at STAT5A were successfully constructed.2.The target sequence of RNA interference which targeted at STAT5 gene were designed efficiently,STAT5A protein expression were inhibited significantly at 48h after STAT5A-1 group,STAT5A-2 group were transfected into HEPG-2 cells.3.The investigation may be to aim directlt at STAT5A gene can inhibit significantly the HCC growth. |