Sequencing And SNPs Detection Of Agouti Gene In Fox

To explore the sequence structure and the regulation mechanism of fox Agouti gene in coat color, the DNA sequences(12670bp) were obtained for Agouti gene of silver fox by the method of PCR amplification, direct sequencing and genome walking, including 5’UTR region of 8022 bp, exon 2 of 157 bp, intron 2 of 1251 bp, exon 3 of 62 bp, intron 3 of 3098 bp and exon 4 of 80 bp. Subsequently, the whole exon 2, whole intron 2 and partial exon 3 sequence of the Agouti gene were sequenced from 58 fox samples, belonging to five species of two genera. A total of six SNPs(g.269G>T, g.295C>T, g.325T>G, g.518G>A, g.608C>A and g.846G>A) in intron 2 were detected firstly, revealing high genetic diversity. All individuals(25) of Vulpes vulpe were homozygous at the six sites, and the genotypes were in order of GG, CC, TT, GG, CC and GG. All individuals(33) Alopex lagopus were another homozygous at the six sites, and the genotype were in order of TT, TT, GG, AA, AA and AA. Total two haplotypes(H1: GCTGCG and H2: TTGAAA) were found at the six mutation sites and their frequencies were 42.1% and 57.9%, respectively. H1 was widely distributed in all tested individuals of Vulpes vulpes, but H2 was widely distributed in all tested individuals of Alopex lagopus. Further analysis showed that the detected SNPs and haplotypes were not significant relation to coat color, but speculated that they may be the important functional sites and haplotypes to distinguish Vulpes vulpe and Alopex lagopus.The further bioinformatics analyses of silver fox Agouti gene promoter region were conducted by using DNAMAN(5.2.9) and Neural Network Pomoter Prediction, etc. Base on comprehensive analysis results, it is reasonable to speculate that the core regulatory sequences of silver fox Agouti gene promoter may be CACACAGCCGCT TAAATAGCAGGTACATCCAGGTGGCCTGACTCCCCTTT and the transcription start site(A) may be in 543 bp region of ATG upstream. The TATA box, CAAT box and some transcription factor binding sites including Sp1, AP1 and NF-1, etc. were detected in the promoter region of fox Agouti gene, but did not find the GC-box.Based on the coding sequences of Agouti gene, the homology and cluster analysis were completed for fox and other eleven species, and the result showed that fox were the closest relatives with domestic dog. The cluster result of phylogenetic tree was similar to the physiological characteristics of the two species and their traditional classification.