Brucine By JAL-STAT Signaling Pathway In Multiple Myeloma U266Cell Adhesion Molecules

ObjectiveMultiple myeloma (multiple myeloma, MM) is a good fat in the malignant proliferation of plasma cells in old age disease, its etiology and pathogenesis have not yet completely clear, now more than that with chromosome abnormalities and oncogene precursor cells, some activation of cytokines in the bone marrow micro-environment changes and the abnormal stromal cells and tumor cells in abnormal expression of adhesion molecules, MM variety of cell surface adhesion molecules, and ECM components of bone marrow stromal cells and the corresponding ligand in combination tumor cells form anchorage independent growth (anchorag e-dependentgrowth) of the molecular basis of bone marrow stromal cells and the ECM network composed of the growth of tumor cells provide a suitable microenvironment.In recent years, multiple myeloma cell factor on the study reported more, and some have been in clinical use. However, adhesion molecules on multiple myeloma research, especially in the clinical study reported less at home and abroad, and did not reach a consensus. Cell adhesion molecule as a cell and cell-mediated cell adhesion and extracellular matrix effects on the membrane surface glycoprotein in cell development, differentiation, maintenance of normal tissue structure, inflammation, tumor development many physiological and pathological processes play an important role in adhesion of the body, covering almost all of the physiological and pathological processes. Multiple myeloma bone marrow cells express a series of adhesion molecules, so that the adhesion of myeloma cells and selective homing substrate for tumor cell proliferation and cytokine provide physical support. Therefore, inhibiting the expression of cell adhesion molecules appears to be very important.MM cell surface CD44, CD54and other adhesion molecules expression of morbidity and recurrence associated with MM, have studied abroad, the use of a series of anti-adhesion molecule monoclonal antibody treatment of MM.Chinese herbal medicine on the tumor cells the role of signal transduction attention has been paid, and there is more and more people in the study. Which Strychnos as a "fire with fire" drug among the representatives, but also a growing concern, and for the clinical treatment of various tumors. Strychnos also known as bitter reality, Fan wood turtle, horse before the child, only contained in the "Materia Medica Gang Mu", Xin Wen big drug, Sanjie swelling, analgesic effect of collaterals, as well as analgesia for the treatment of all kinds of inflammation and arthralgia. Strychnine is the main component of strychnine (Strychnine), strychnine (Brucine) and other indole-type alkaloids.JAKs (Janu sk inases) are a class of protein tyrosine kinase, receptor binding cytokines and activation of JA K, and then activate the signal transcription and activator of transcription (signal transducer and act ivato roftran scription, STAT); stress can also activate the JAK-STAT signal transduction, and then induced gene expression. JAK-STAT pathway abnormalities and the development of a variety of malignant tumors are closely linked.AG490is a JAK-STA T-specific signal transduction pathway inhibitor, synthetic benzylidene malononitrile lipid derivatives, molecular formula C17H14N2O3, molecular weight of29,413, the structure similar to the tyrosine. The mechanism is competitive with the tyrosine kinase binding sites, inhibition of JAK and STAT phosphorylation substrate, thereby blocking the JAK-STAT pathway conduction.Methods1. Cell culture:containing10%fetal bovine serum, RPMI-1640culture medium human multiple myeloma cell line U266, at37℃with5%CO2, incubator passage,2-3days time, to collect logarithmic phase cells were used in experiments.2. MTT method:Take containing5×104U266cells were inoculated to96well culture plates with different concentrations of strychnine, to a final concentration of0.05,0.1,0.2,0.4mg/mL; set blank wells and control holes each concentration for three parallel holes, mix into the CO2incubator for culture.24,48,72h in culture were removed one of the board, the MTT test. Inhibition rate calculated according to the formula. The experiment was repeated3times.Inhibition rate=(A value of the control hole-A hole treatment value)/control×100%value of hole AlgIC50=Xm-I (P-(3-Pm-Pn)/4)(Xm:1g the highest dose I:1g (maximum dose/dose adjacent) P:positive rate and Pm:the maximum positive rate of Pn:the smallest positive rate)3. Cytometry:Take control group and experimental group on the logarithmic growth phase cells, the cell suspension into50ml centrifuge tubes,1000rpm centrifugation for5minutes, the supernatant, and then normal saline wash,1000rpm centrifugation for5minutes, to the supernatant, counted cells, CD44, CD54were blank control group, strychnine group, AG490group three groups, the inclusion of the three groups in the CD44PE labeled monoclonal antibody, the inclusion of the three groups in CD54FITC fluorescence monoclonal antibody, each1×106/ml cells were added20μl, incubated for half an hour at room temperature away from light, flow cytometry. 4. RT-PCR method:detection of stat3, stat5mRNA expression:the1×106/ml cells were seeded in culture bottles,24h after the addition disposable culture medium was added containing0.16mg/ml strychnine,50μmol/LA G490,50μmol/L AG490+0.16mg/ml strychnine in the culture medium to cells without drug as control. The role of24h,48h after the cells were collected, respectively, used in the experiment. Extracted after cell RNA. Then reverse transcription, and PCR reactions occur. stat3primer:,5’ctggcctttggtgttgaaat3’, downstream primer:5’aaggcacccacagaaac-acaac3’, amplified fragment length of202bp, annealing temperature of50.6℃. stat5upstream primer:5’gtcacgcaggacacagagaa3’, downstream primer:5’cctccagagacacctgcttc3’, amplified fragment length of178bp, annealing temperature of56.6℃. β-actin upstream primer:5’TCCACCGCAAATG-CTTCTAG3’, downstream primer:5’ TGCTGTCACCTTCACCGTTC3’, amplified fragment length of189bp, annealing temperature of50.4℃. Absorbance value analysis to target gene and β-actin amplification products, said the ratio of the absorbance value of the expression.5. Statistical Methods:Multiple myeloma proliferation rate of U266cells, multiple myeloma U266cells stat3, stat5mRNA expression with that. SPSS13.0statistical software used for statistical analysis, the two groups using t test, compared with single factor multiple analysis of variance, pairwise comparisons among groups using LSD method.ResultsThrough this study, we found that:1. Brucine on the multiple myeloma cell proliferation rate in a dose and time dependent. Taking different concentrations of strychnine effect on multiple myeloma U266cells measured0.05mg/mL brucine24,48,72h inhibition rate was0.8213±0.1742,0.5883±0.1977,0.7463±0.2112;0.10mg/mL brucine24,48,72h proliferation inhibition rate was0.8872±0.1747,0.9670±0.1475,0.9887±0.1354;0.20mg/mL strychnine24,48,72proliferation inhibition rate was1.1227±1.0324, respectively,1.3474±1.1792,1.4575±1.1845;0.40mg/mL strychnine were24,48,72proliferation inhibition rate was1.2117±1.1296,1.3552±1.1001,1.7432±1.2132, with that, there was significant (P<0.05).2. Brucine and the AG490can be reduced with multiple myeloma U266cell adhesion molecules CD44, CD54expression. Were divided into three groups, control group, Join The brucine group, joined the AG490group, CD54values measured in each group and the mean fluorescence intensity of positive rates were:0.9143±0.0122,0.4435±0.0786;0.8893±0.0215,0.3200±0.0065;0.4228±0.0352,0.1944±0.0045. Use that was statistically significant (P<0.05).3. Brucine, AG490can be reduced stat3, stat5mRNA expression level (P<0.05) and brucine stronger than that of AG490group, and time-dependent manner. Strychnine+AG490group was stronger than strychnine, AG490alone group, time-dependent manner. In the control group, AG490group (50μmol/L), strychnine group24(0.16mg/mL), strychnine plus AG490(50μmol/L+0.16mg/mL), four groups of expression measured STAT3RNA were:0.6237±0.0292,0.5804±0.0135,0.4046±0.0067,0.1235±0.0023, STAT5RNA expression were:0.6206±0.0246,0.5920±0.0058,0.4086±0.0034,0.1254±0.0022, using X±S said there were statistically significant (P<0.05). Brucine group (0.16mg/mL), strychnine plus AG49024(50μmol/L+0.16mg/mL)24,48compared with24hours of the two groups were:0.4046±0.0067,0.1235±0.0023;48<小时two group were:0.2186±0.0175,0.0023±0.01358, with that, there was significant (P<0.05).Conclusion1. Brucine on the multiple myeloma cell proliferation rate in a dose and time dependent.2. Brucine to multiple myeloma U266cell surface adhesion molecules CD44, CD54expression was decreased, and the JAK-STAT signal transduction pathway mediated pathway.3. Brucine with the JAK-STAT inhibitor AG490in reduced STAT3, STAT5mRNA a synergistic effect on the expression of the process and time dependent.