| Background and PurposeNeonatal bacterial meningitis is a serious and very common infection of the central nervous system with the high rates of mortality and incidence of complications,30%~50% patients with neurological sequelae such as cerebral palsy, epilepsy, etc. Among them, E.coli (Escherichia coli,E.coli) K1 E44 is caused by neonatal meningitis and bacteremia primary pathogenic gram negative bacteria, the key of blood borne infection caused by E.coli K1 strain. In the neonatal period, intestinal colonization of E.coli Kl strain is easily attached on Mother’s vagina, causing the newborns to be infected through the birth canal. In case of Escherichia coli K1 strains are colonized,0.5% of them would result in the intestinal location of invasion and the metastasis in the blood to cause meningitis through the blood brain barrier. Hence, the four keys of the pathogenesis of K1 E.coli strain piercing through the intestinal epithelium are paid attention to as follows:1. the high-level bacteremia; 2. the invasion of micro vascular endothelial cells in the brain; 3. the receptor guide transcytosis and its related signal transduction; 4. the effective intervention of viable bacteria cross the blood brain, which have become one of the important measures for prevention and treatment of meningitis and bacteremia.Mucin (referred to as Muc), as the main component of mucus gel, is a macromolecule glycoprotein which is synthesized and secreted by the specialized goblet cells locating on the mucosal surface or in the crypts, and exists widely in a variety of epithelial tissues such as gastrointestinal tract, respiratory tract, the genital tract, etc. According to the difference of the core protein (apomucin), so far,21 kinds of mucin genes have been identified (MUC1-4, MUC5AC, MUC5B and MUC6-MUC21), in which the main functions involve in antigen presentation, cell adhesion, signal transduction and immune regulation. Among them, MUC2 is a mucin core peptides gene which had been cloned by the American scholar Gum, et al. in 1989 from CDNA expression library of human small intestinal mucosa, locating on the chromosome 11p15.3~15.5, and also is a major gene of compile secreting type of mucin Mucin2 (Muc2). Mucin Muc2 is the main form of ileocolon mucin and is also the main component of the intestinal mucus layer, with the characteristics of tissue specificity and cell specificity. In normal, only in the small intestine and jejunum goblet cells it would be expressed and the expression is rather low, which can form a mucus layer on the epithelial surface of the intestinal cavity to play the role of adhesion and invasion of pathogenic bacteria by lubrication and antagonism. R.Mack, et al. have confirmed that mucin secreted by epithelial cells, can prevent pathogenic protein EPEC from contacting with intestinal epithelial cells, to avoid infection caused by adhesion of EPEC, etc. on intestinal epithelial cells. It was also found in our previous study which the sticky protein not only in intestinal mucosa is strongly expressed and also appears the structural and functional changes of quantity and quality in many kinds of epithelial intestinal diseases and tumors.Probiotics is a kind of active microorganism that effects by improving the host intestinal microflora balance, which plays an important role in improving the structure of intestinal flora, inhibiting pathogen invasion and enhancing body immunity etc. Studies at home and abroad have been proved that probiotics can effectively adhere to intestinal epithelial cells, through their own and by producing metabolites and inhibitor to exclude pathogen. The probiotics preparation can inhibit pathogen adhesion to intestinal epithelial cells with intestinal mucin expression of Muc2 and Muc3 as the media, and through strengthening intestinal mucin secretion to produce spatial disorder or imitate of the bacterial binding sites of epithelial cells for competitive inhibition. In recent years, there are studies found that the Lactobacillus rhamnosus GG strain could significantly inhibit intestinal adhesion and invasion of E.coli Klstrain of neonatal rats so as to reduce the incidence of meningitis, which is more effective in the functional aspect of strengthening the intestinal barrier. Therefore, whether there is common or whether there is a link to each other for Muc2 gene and Lactobacillus rhamnosus GG (LGG) strains inhibiting of adhesion and invasion of pathogenic intestinal bacteria will be a hot topic of the preventive treatment of probiotics in the next few years.It is carried out to identify the target area (Protospacer-Adjacent motif) on PAM and near PAM 11bp seed sequence through the completely-conserved CRISPR/Cas9 system into which is transformed from the immune system existing widely in bacteria and archaea and obtained conservatively. Available since 2013, it has marked a next revolutionary modification technology of targeting gene. Among them, sgRNA and protein are the core of exciting activity in the entire system. Through the obtaining of the highly variable spacer of CRISPR, the expressing of CRISPR locus (including pre-crRNA transcription and subsequent and mature processing) and the scanning of exogenous DNA to find and combine to form a combined target sequence, the nuclear protein complex combined with crRNA, tracrRNA and Cas9 is made to interfere invasive alien phage or genetic material after the paired cutting of exogenous DNA at a specific location. Compared to the ZFN (zinc finger nuclease) and TALEN (transcription activator like effector nuclease CRISPR/Cas9), there are still a lot of research to be carried out in spite of the short time of it available. With its simple construction, high specificity and accurate incision enzyme activity, CRISPR/Cas9 has a broad application prospect in the following future. Further to explore the functional mechanism of probiotics enhancing intestinal barrier and comparatively to analysis the similarities and differences of probiotics between the alone prevention and the regulation of mucin Muc2 in adjuvant treatment of intestinal bacterial infection, this study has made use of the new type of gene modification technique CRISPR/Cas9: by inserting the target sgRNA (double stranded oligonucleotides) into the lenticrisprv2 plasmid vector digested with enzyme, to interfere the Muc2 gene expression by means of transfecting the wild type of Ht29 cells and to construct the Ht29 cell model of human colon carcinoma modulated under the Muc2 gene expression, in order to understand the relationship between the mucin Muc2 and LGG in inhibiting the E.coli K1 strain E44 adhesion and invasion of intestinal barrier.Methods1.Construction and identification of the expression vector of Muc2 sgRNA eukaryotic plasmidby querying the MUC2 gene sequences in the NCBI gene pool, and according to the CRISPR/cas9 system sgRNA of 20 mer target DNA sequence recognition requirements target sequence followed by a-NGG (n represents ATGC an arbitrary base) PAM sequence design principles, screening sequence specific mutation target for inhibition, using sgRNA website design (http://www.e-crisp.org/E-CRISP/designcrispr.html) synthetic 8 MUC2 oligo single design, sequence see Table 1, italics for the activity of BsmBI cutting sites of.The sgRNA oligonucleotide single strand annealing form double-stranded DNA; restriction enzyme digestion lenticrisprv2 plasmids within BsmBI restriction that CRISPR lentivirus plasmid digested and dephosphorylated; lenticrisprv2 linearized plasmid and digested sgRNA connection, the connection system:2 u 1 BasBI digested plasmid; 6μ1 vector; 1μ1 T4 DNA ligase; 1μ1 ligase; 10μ1 total,16℃ connection 12h build lenticrisprv2-sgRNA, ligation products transformed into E. coli DH5-a competent cells, after positive identification of recombinant small lift The plasmid and verified by sequencing. Appropriate packaging plasmid pCMV-dR8.2 dvpr and plasmid pCMV-VSV-G may also be extracted, concentrated and low-cut plastic recycling.2. Lentivirus construct and transfected into human colon cancer cells Ht29:48h after untransfected Ht29 cells were seeded in 6-well plates containing different concentrations of added Puromycin. Complete medium, concentration gradient were Oμg/ml, 1μg/ml,2μg/ml,3μg/ml,4μg/ml,5μg/ml,6μg/ml,7μg /ml, the way to his death after 5d observation, shape, time, the lowest concentration in the cell culture plate to take all died as a working concentration Puromycin screening. Calcium phosphate transfection method, by mixing plenticrisprv2-sgRNA, pCMV-dR8.2 dvpr and pCMV-VSV-G, transfected HEK293T cells. Using PEG8000 to collect the purified lentivirus,0.45μm membrane filter,24-well plates transfected human colon carcinoma cells and screening Ht29 stable strains.3. Western blot detection of Muc2 DNA interference efficiencyLogarithmic growth phase monolayer culture cells, total protein was extracted and BCA protein quantification method. Take 60μg protein samples by SDS-PAGE polyacrylamide gel electrophoresis. Transmembrane,5% skim milk at room temperature blocking solution -TBST 1h, PVDF membrane in the antibody, incubated overnight at 4 deg.] C shaking. PVDF membranes removed,0.01M PBS washing the membrane three times, each time 5min. The PVDF membrane was shaken at room temperature and incubated with secondary antibodies for 2h,0.01M PBS washing the membrane three times, each time 5min. Developer dropped to a PVDF membrane, chemiluminescent imager imaging.4. Detection of probiotic-induced neonatal rat intestinal Muc2 gene expression 12 2-day-old SD rats were randomly divided into groups probiotic LGG probiotic bacteria LGG+E44 group, bacteria E44 group and control group. 1-4d: LGG probiotic group, probiotic bacteria LGG+E44 group suckling mice fed LGG (109CFU/only), pathogens E44 group and control group suckling mice fed an equal volume of sterile PBS; 5-7d:probiotic bacteria LGG+E44 group while neonatal rat oral administration of LGG and E44 (109CFU/only), then set oral bacteria E44 E44 (109CFU/only), the control group still received the equal volume of sterile PBS; 8d: whichever colon; RT-PCR semi-quantitative method to detect MUC2 gene expression. Trizol extraction of tissue RNA, reverse transcribed cDNA, take 3μg total RNA PCR reaction to GAPDH as internal control. PCR reaction primers MUC2-F:ACAAAAACCCCAGCAACAAG; MUC2-R:GAAGTCGGGACAGGTGATGT; GAPDH-F:GAGACAGAAACTTTCGAAGC; GAPDH-R:GAAGTCTGTGGTATCCAATCCAccording to 95℃ 5min,95℃ 30s,55℃ 30s,72℃ 30s for 30 cycles, 72℃ 5min fully extended. Take 5 u 1 extension products were 2% agarose gel electrophoresis and gel electrophoresis analysis of gray.5. Use MTT assay and cell counting to detect colon cancer cell Ht29 viability and growth after Muc2 silencingTo detect cell viability and growth, thereby selected the appropriate cell inoculation concentration and incubation time. Logarithmic growth phase monolayer cultures Ht29/KD-MUC2-Ht29 cells were resuspended and counted after digestion. Press 10,000cells/ml seeded into 24-well plates. Remove the 3 holes per 24h cell hemocytometer count. In cell number on the vertical axis, horizontal axis culture time cell growth curve; determining cell inoculation concentration and incubation time after the logarithmic growth phase of the single-Ht29/KD-MUC2-Ht29 cells were centrifuged after digestion, and resuspended counting, adjusting the cell concentration of 10,000 cells/ml and a cell growth curve by MTT were measured at 24,48,72,96h. OD value to the longitudinal axis of the incubation period was horizontal growth curve cells. The experiment was repeated three times.6. Use monocyte adhesion competitive assay after Muc2 silenced to detect monocy te adhesion case of E. coli Kl strain E44 infecting Ht29 which inhibited by Lactobacillus rhamnosus GG strain48 hours before the experiment carpeting Ht29 24 well plate 106cell/hole, the experiment BHI medium diluted E44 strain 106cfu/ml standby, experimental strains LGG MRS broth diluted 107cfu/ml in reserve, the following conditions stimulate single Ht29:E44+LGG treated by (107CFU LGG+106CFU E44)/well of culture 24-well cell culture plate Ht29 cells incubated volume of fresh 3h, E44 and other treatment groups with complete culture medium instead of LGG.0.5% Tri ton X-100 200μl/hole incubation 10min, after dilution was applied on LB agar plates containing rifampicin,24h after counting the number of colonies.7. Use monocyte invasion competitive assay after Muc2 silenced to detect monocyte invasion case of E. coli Kl strain E44 infecting Ht29 which inhibited by Lactobacillus rhamnosus GG strain48 hours before the experiment carpeting Ht29 24 well plate 106cell/hole, the experiment BHI medium diluted E44 strain 106cfu/ml standby, experimental strains LGG MRS broth diluted 107cfu/ml in reserve, the following conditions stimulate single Ht29:E44+LGG treated by (107CFU LGG+106CFU E44)/well of culture 24-well cell culture plate Ht29 cells incubated volume of fresh 3h, E44 and other treatment groups with complete culture medium instead of LGG. Change into fresh complete medium (containing 100μg/ml gentamicin) was incubated 1h.0.5% TritonX-100 200μl/hole incubation 10min, after dilution was applied rifampicin-containing agar plates,24h after counting the number of colonies.Results1. The colony PCR and DNA sequencing result of the recombinant plasmid sgRNA expression vectorsSelected monoclonal strain, previously inoculated added 50μl of double distilled water in a centrifuge tube (10 taking,1 colony/time, tag), shaken.20μl PCR system: 2μl template; 1μl upstream primer; 1μl downstream primer; 10μl rTaq; 6μl ddH2O; 20μl total,95℃ 5min initial denaturation→95℃ 30s denaturation→56℃ 30s annealing→72℃ 30s extend→72℃ 5min again extension→4℃∞. Colony PCR analysis showed that all the recombinant plasmid were positive, two typical selection of clones from each plate were sequenced. After the primer sequencing, sequencing results and involved sgRNA nucleotide consensus sequence showed that the target double-stranded oligonucleotide sgRNA successfully inserted lenticrisprv2 digested lentivirus expression vector and the correct sequence, recombinant subsequent experiments required plasmids.2. Changes in their protein level after Muc2 silencedStable inhibition of cell lines Muc2 expression screening of success; after Muc2 gene silencing, the total cellular protein extraction and protein quantification upon expression Muc2 protein after blotting silence, protein immunization achieved SDS-PAGE results and the target gene and internal reference article band optical density analysis, compared with the control group, the expression levels were significantly lower inhibition rate of 81%(P<0.01).3. Muc2 silence will not damage the cell viability and growth impactCell counting and MTT assay Muc2 downregulated Ht29 cells and growth curve and the curve of normal convergence HT29 cells showed around Muc2 missing two cell activity and growth is good, there is no significant difference in the growth curve and the convergence rate curve. Ht29 estimate normal cell population doubling time is about 26h, KD-MUC2-Ht29 cell doubling time is about 24h.4. Muc2 silencing reduce adhesion ability of probiotics inhibiting E44In vitro analysis of competitive exclusion Muc2 silence antagonistic E44 cell adhesion wild type Ht29 regulatory role in probiotics. The E44 treatment group adhesion rates assumed when co-incubated with 100% standardized LGG and E44 opposite adhesion rate E44 (relative adhesion rate%=number of colonies (LGG+ colonies E44 treatment group/E44 treatment group)×100%). Gene expression Muc2 down before, E44 relative adhesion was 15.38%, significantly inhibited the probiotic LGG bacteria adhesion and invasion Ht29 E44 cells (P<0.01); after Muc2 gene silencing, relative E44 adhesion rate of 72.23%, probiotic LGG interfere significantly lower (P<0.01)5. Muc2 silencing reduce invasion ability of probiotics inhibiting E44In E44 treatment group attack rate assumed when incubated with 100% standardized LGG and E44 opposing the invasion rate of E44 (as opposed to the invasion rate%=number of colonies (LGG+colonies E44 treatment group/E44 treatment group) x 100%). Before Muc2 gene silencing, E44 relatively invasion was 25.13%, significantly inhibited the probiotic LGG bacteria adhesion and invasion Ht29 E44 cells (P<0.01); after Muc2 gene silencing, E44 relatively invasion was 81.49%, the probiotic LGG interference role significantly lower (P<0.01)6. Probiotics can significantly induce MUC2 expression regulating in mouse intestinal, which were antagonistic to bacteria.Using 12 SD rats after 7d administration, total RNA was extracted colon tissue, using semi-quantitative RT-PCR method suckling mouse intestinal Muc2 detect gene expression. In vivo results corroborated mucin Muc2 suppress adhesion and invasion of pathogenic bacteria in the intestinal barrier plays a crucial role in probiotics, compared with the control group, the group administered probiotic Muc2 gene expression was significantly increased (P<0.01), induced significantly lower (P<0.01) bacteria administration group Muc2 gene expression; and LGG administration group result+E44 and E44 administration group for comparison, the probiotic LGG significantly inhibit E.coli K1 strain E44 induce secretory mucin Muc2 gene expression. (P<0.01)Statistical analysisData are shown in mean±standard deviation. The statistical approach adopts one-way ANOVA of SPSS 13.0 statistical software and variance analysis of repeated measurement data, transformation of variables at heterogeneity of variance. The difference is statistically significant when P<0.05.Conclusion1. Use CRISP/Cas9 to establishe Ht29 complete △Muc2 cell model in wild-type human colon cancer cell lines; Inner Ht29 cell Derived Muc2 at the protein level was significantly decreased up to 81% for lenticrisprv2-sgRNA plasmid, and the gene silencing had no significant changes in cell growth curve proving that the cell model is effective.2. Muc2 gene silenced obviously decreased the E44 adhesion and invasion to intestinal epithelial which was inhibited by probiotics, and probiotics also played a preventive role in suppressing pathogenic bacteria to intestinal epithelial injury through MUC2 upregulation. |