The wide impact and the potential risks of transgenic technology commercialization require effective tracking,monitoring,risk assessment and identification of genetically modified(GM)organisms and products.In China,the relevant laws and regulations on safety evaluation standards and management systems for GM organisms and products have been issued,including the product-centered mandatory labeling system for five types of GM crops(soybean,corn,cotton,rapeseed and tomato)as well as 17 kinds of GM products.A rapid and accurate detection technology for transgenic products is the technical prerequisite for implementing the labeling system and the foundation of safety evaluation and management of GM organisms and products.In this study,using a Cry1Ab gene insect-resistant rice as the experimental material,through preliminary screening of primer,specificity test,optimization for annealing temperature and concentration of primers,detection limit and reproducibility test,verification test of processed products,ordinary polymerase chain reaction(PCR)qualitative detection method,the real-time fluorescence quantitative PCR detection method and double droplets type digital PCR detection method were set up.The main results were as follows:(1)A normal PCR qualitative detection method of transgenic insect-resistant rice was set up.The suitable primers and probe combinations were: upstream primer 5'-F4 5'-ATCTGTTTACTCGTCAAGTGTCATCTC-3',downstream primer 5'-R1 5'-GCCATGGATTACATATGGCAAGA-3' with primer concentration 0.6 mu mol/L.The optimum annealing temperature was 56?.This method can detect not less than 0.05 ng insect-resistant rice genome and 1% positive component of processed products after the high temperature treatment with good reproducibility.(2)A real-time fluorescence quantitative PCR detection system for transgenic insect-resistant rice was set up.The best upstream primer was 5 '-QF1 CGACGTAGACGACTC,downstream primer was 5'-QR3 ACGACATATAGGCAAGA,and the best probe was 5 '-QP1 AGCCACTGCGGCTTGATCAA with the optimum primers and probe concentrations 1.0 mmol /L and 0.5mmol /L respectively.The correlation coefficient and amplification efficiency of the standard curve can meet the requirements of GM components testing standard in China.The method was able to detect ?0.025 ng DNA of the GM insect-resistant rice and the processed products after high temperature treatment containing 1% positive components.(3)A double microdroplet digital PCR detection system for transgenic insect-resistant rice was set up.The optimum primers and probes were selected by the real-time PCR.Through optimizing reaction system and program,stability test,the specificity test,and quantitative linear range and LOQ validation tests,the optimum concentration of primers and the probe were 400 nM and 200 n M,respectively,the optimum annealing temperature was 60.4 ?.The quantitative linear range of insect-resistant transgenic rice specific sequence was 42.8-17000 copies,with detection limit 0.05 ng DNA,while,the PLD quantitative linear range of rice endogenous gene was 26.4-36133 copies,with detection limit 0.01 ng DNA. |