| Excitatory amino acid transporters(EAATs)are Na+-dependent excitatory amino acid transporters whose main function is to regulate the concentration of excitatory amino acids inside and outside the cell.Some studys found that the expression of EAAT3 is decreased in hippocampus-related learning and cognitive function.There is a correlation between damage.As a plasmid shuttle vector,Recombinant adeno-associated virus(rAAV)has the advantages of high safety,low immunogenicity,wide host range,stable expression and stable physical properties.It is an effective gene delivery vector system.Short hairpin RNA(shRNA)can be cleaved by nuclease into double-stranded siRNA in the cell,which binds to the target mRNA target and promotes the degradation of target mRNA.It is also a widely used gene regulation tool.Although several studies have been conducted on the regulation of EAAT3 function,no highly selective compounds have been found.This study aims to establish an animal model that knocks down the expression of EAAT3 in mouse hippocampus by constructing a rAAV vector capable of expressing shRNA.Study the EAAT3 regulatory mechanism and related molecular signaling pathways to lay the foundation for research.Part ? Establishment,identification and screening of EAAT3 knockdown rAAV vectorObjective Establish EAAT3 knockdown rAAV and its control rAAV which would become the foundation of our new animal model.Methods Based on the SLC1A1(solute carrier family 1 member 1)gene mRNA sequence,four shRNA encoding genes mSLC1A1-1,mSLC1Al-2,mSLClAl-3,mSLC 1A1-4 and one negative control sequence NC were designed,and the pAAV-U6 was digested with the enzyme.The EGFP vector plasmid was ligated and transformed,and the positive plasmid was picked for sequencing.The correctly sequenced recombinant plasmid,pHelper packaging plasmid and pAAV-DJ helper plasmid were co-transfected into AAV-293 cells to obtain rAAV-shRNA-SLClA1-1-EGFP,rAAV-shRNA-SLC1A1-2-EGFP,rAAV-shRNA-Five kinds of rAAVs,SLC1A1-3-EGFP,rAAV-shRNA-SLC1A1-4-EGFP,and rAAV-shRNA-NC-EGFP.HT-22 cells were infected with the obtained rAAV,and the expression level of SLC1A1 mRNA was detected by RT-qPCR 72h later.Results The recombinant plasmid was identified by sequencing,and the insertion position and sequence were consistent with the design.The recombinant interference plasmid was successfully constructed.The titer of recombinant infection was determined by finite gradient dilution method.The titer of recombinant infection was about 1×1013 TU/ml.The relative expression of SLC1A1 gene was analyzed by 2-??Ct method.Compared with the NC group,there was no significant difference in the mSLC1A1-3 group.The expression of SLC1A1 in the mSLClA1-1 group and the mSLC1A1-4 group decreased(P<0.01),and the expression level in the mSLC1A1-2 group was about 42%in the NC group.P<0.01)Conclusion EAAT3 knockdown rAAV was successfully constructed,and the adeno-associated virus rAAV-shRNA-SLC1A1-2-EGFP with the interference sequence of"GCTGATCGTATCCAGCATGAT"(5'-3')was the best to inhibit the expression of EAAT3.Part ? Effect of hippocampal injection of rAAV on behavior of mice with cognitive impairment induced by LPSObjective The expression level of EAAT3 was detected in hippocampus of mice after injection of rAAV,and the EAAT3 knockdown model was constructed.Methods 72 adult C57 mice were randomly divided into 6 groups,12 in each group.The hippocampus was injected with rAAV-shRNA-SLC1A1-2-EGFP virus solution 1?gL/side(1×1013 TU/mL).Immediately after injection,24h,7d,14d,21d,and 28d the mice were taken from bilateral hippocampus.Six mice of each group were randomly selected to detect the expression level of EAAT3 by RT-qPCR and Western blot.Results Compared with the control group,the expression of EAET3 in hippocampus of mice decreased with time,and the basic trend of the two experimental results was the same.On the 21st day after hippocampal injection,the mRNA expression decreased to 43.1%of the control group(P=0.043).The protein expression decreased to 37.4%(P<0.01);on the 28th day after injection,the transcription and translation products decreased to 30%and 25%of the control group,respectively(P<0.01).Conclusion Hippocampal injection of rAAV-shRNA-SLClA1-2-EGFP can effectively knock down the expression of EAAT3 in adult mouse hippocampus,and the expression level is the lowest at 28 days after injection.Part ? Effect of hippocampal injection of rAAV on behavior of mice with cognitive impairment induced by LPSObjective Using brain-injected LPS-induced cognitive dysfunction model mice to observe the effects of hippocampal injection of rAAV on cognitive-related behavior in mice.Methods 48 adult C57 mice were randomly divided into 4 groups,12 in each group.The negative control group(NC group),the EAAT3 knockdown group(RNAi group),the cognitive impairment group(LPS group),and the cognitive impairment with EAAT3 knockdown group(LPS+RNAi group).The bilateral hippocampus of the NC group and the LPS group were injected with the control virus solution AL/side,and the bilateral hippocampus of the RNAi group and the LPS+RNAi group were injected with the effect virus 1 ?L/side(1×10 13 TU/mL).After 21 days,2 ?L of aCSF was injected into the lateral ventricle of the NC group and the RNAi group,and 2 ?L(1000 ng/? L)of the LPS solution was injected into the lateral ventricle of the LPS group and the RNAi+LPS group.All animals were tested for open field on the 15th day after hippocampus injection.From the 16th day water maze space was acquired for 5 days.The lateral ventricle was injected 21 days,and the space exploration test and working memory test were performed 1-3 days after the lateral ventricle injection.Results There was no significant difference in the distance between the movements of the animals in the open field experiment and the total time of exercise.The latency of the water maze space acquisition training group(s)gradually shortened from the first day to the fourth day,training 4th and 5th.There was a statistically significant difference in the duration of the incubation period compared with the first day(P=0.024).There was no significant difference between the total swimming distance and the average speed of the mice in the space exploration test.The other groups were statistically significant(P=0.034),and the differences between the other groups were not statistically significant.The number of NC subjects in the target quadrant was higher than that in the RNAi group and the LPS+RNAi group(P=0.037),and the LPS was higher than the LPS.+RNAi group(P=0.037).On the first day of the working memory test,the NC stage latency was lower than that of the LPS+RNAi group(P=0.029).Conclusion Knockdown of mouse hippocampal EAAT3 can reduce the performance of mice in behavioral tests and can aggravate cognitive impairment caused by LPS. |
PDF Full Text Request