| Background Neurofibromatosis type I(NF1)is a common autosomal dominant genetic disease in the clinic.The prevalence of NF1 is estimated at approximately 1 in 2000-3000 individuals.Patients have different clinical phenotypes,but the most common manifestations are café-au-lait macules,axillary and inguinal freckling,multiple neurofibromas and iris Lisch nodules.Abnormal mutations in the NF1 gene leads to multi-system damages.By far,more than 2,700 mutations in the NF1 gene have been reported,including missense mutations,nonsense mutations,insertion or deletion mutations,and splice site mutations,most mutations can cause truncated neurofibroma proteins.In recent years,about gene detection methods,the development of nextgeneration sequencing(NGS)has provided a more convenient and efficient means for the detection of related gene mutations.Among them,panel targeted capture sequencing is the exon targeted capture and large-scale parallel sequencing of the researchful diseaserelated genes to screen out pathogenic genes.Objective Targeted capture sequencing combined with first-generation Sanger sequencing was used to detect genes related to dermatosis in one pedigree and two sporadic cases which have café-au-lait macules as the main clinical manifestations,to help clinical diagnosis and explore it’s pathogenesis.And through referring the bioinformatics information,to further understand the pathogenesis of neurofibromatosis type 1,which can provide a certain theoretical basis for future clinical research on new disease treatment methods,and also lay the foundation for patients’ genetic counseling and prenatal diagnosis.Methods 1.Collect clinical data and peripheral blood of patients and relatives.2.The peripheral blood is used to extract DNA.Kapa Illumina HTP,Seq Cap library adapter kit,Seq Cap EZ hybridization enhancement kit and covering 569 gene-targeted probe kits closely related to hereditary skin diseases is used for library preparation and capture on the Illumina Hiseq X Ten sequencing platform.Mutation sites were obtained after data analysis and mutation annotation.3.Specific primers were designed for the mutation sites that obtained from targeted capture sequencing.The mutation sites were verified by Sanger sequencing,and the sequencing results were analyzed by Chromas 2.6 software and Bioinformatics software.Results 1.In clinical manifestations,all patients showed Café-au-lait macules and no other clinical manifestations.Examination of Dermoscopy and RCM revealed hyperpigmentation at lesions.2.The sequencing results show that in pedigree 1,a TATAACTGTAACTCCTGGGTCAGGGAGTACACCAA sequence that count in 35 bp was inserted between base 5072 and base 5073 located in exon 37,causing a gene frameshift mutation,and the same mutation site was also detected on his father.In sporadic case 1,c.4110+1G>T located in exon 30 and it is a mutation in the splice site.Using the Ensembl database to compare the exon bases of the gene,it was found that the mutation site is located at the first base of the intron between exons 30 and 31,Human Splicing Finder was used to predict exon splice sites,it is shown that the mutation is located at the splice site receptor,and the mutation may destroy the original splice receptor.In sporadic case 2,c.C3826 T located in exon 28,the 3826 th base of exon 28 was mutated from C to T,This mutation is a nonsense mutation and will cause the peptide chain to terminate prematurely when it reaches the 1276 th amino acid position.Conclusion Targeted capture sequencing combined with first-generation sequencing can accurately,quickly and economically detect the mutation sites of known pathogenic genes.Through genetic testing of one family and two sporadic cases,the clinical diagnosis was confirmed,and new gene mutation sites were found,which enriched the spectrum of pathogenic gene mutations in neurofibromatosis type1.The research on the pathogenesis of neurofibromatosis type1 also provides a certain basis for clinical disease treatment,disease consultation and prenatal diagnosis. |
PDF Full Text Request