Research On Gene And Molecular Mechanism In Three Pedigrees With MYH9-related Disorder

Objective: In order to make a definitive diagnosis of three pedigrees with thrombocytopenia and provide genetic counseling,three thrombocytopenia pedigrees in this study would be genetically diagnosed and explored by the investigation on pedigree data and targeted sequence capture combined with Next-generation sequencing.Methods:1.Probands’ clinical data and pedigree investigation were conducted to assess the clinical phenotype,and the peripheral blood of probands and their family members were collected for morphology analysis by Wright-Giemsa stain.2.The genomic DNA extracted from peripheral blood of subjects was captured for Next generation sequencing,and the results were verified by Sanger sequencing.3.Genotype-phenotype co-separation combined with bio-information tools was used to analyze the pathogenicity of gene mutations.4.Non-muscle myosin heavy chain ⅡA in neutrophil was analyzed by immunofluorescence,and the ultrastructure of platelet and neutrophil was observed by transmission electron microscopy in proband who has novel variant.Results:1.In this study,three pedigrees with thrombocytopenia were investigated.Family investigation revealed six patients in the pedigree Ⅰ with sixteen members,one case with kidney disease,one case died of kidney disease;four cases were previously suggested with thrombocytopenia,and four cases were shown with platelets and neutrophil inclusions in pedigree Ⅰ.In pedigree Ⅱ with four members,there were two patients suggested with thrombocytopenia,large platelets and neutrophil inclusions.The proband in pedigree Ⅱ had a sudden hearing loss,while the father was shown with no abnormalities.No patient was suggested in the pedigree Ⅲ with seven members,except the proband who had the large platelets and neutrophil inclusions in peripheral blood.2.Gene sequencing showed that MYH9 c.4270G>A(p.Asp1424Asn)was investigated in proband and his cousin in pedigree Ⅰ,while his elder sister was normal.In pedigree Ⅱ,the proband and her father were suggested with MYH9 c.5818＿5819ins AATGGCCCGGAAAGGCGCCG,leading to a premature stop in the protein,p.G1940Efs*15,and her mother had no mutation in MYH9.The proband in pedigree Ⅲ was revealed with MYH9 c.283G>A(p.Ala95Thr),while his parents were not.3.MYH9 p.Asp1424 Asn and p.Ala95 Thr have been reported in mutation database,while the MYH9 p.G1940Efs*15 is a novel variant.Genotype-phenotype correlation analysis showed that MYH9 p.G1940Efs*15 was co-separated with macrothrombocytopenia in pedigree Ⅱ.Bioinformatics analysis showed MYH9 p.G1940Efs*15 was a pathogenic mutation due to its destruction in the partly conserved region,the loss of the S1943 phosphorylation site and the change of charge status in the non-helical tail domain.4.Immunofluorescence was performed for the patient with novel variant,and showed the abnormal accumulation of non-muscle myosin heavy chain ⅡA in neutrophil.These inclusions were spindle,and made of parallel microfilaments along which ribosomal particles were distributed under electron microscopy.Additionally,mitochondrial swelling and uneven distribution of contents were observed in platelets under electron microscopy.Conclusions: In this study,two pedigrees and one sporadic case were definitely diagnosed as MYH9-RD.Both the MYH9 p.D1424 N and p.A95 T have been reported previously.In pedigree Ⅱ,MYH9 p.G1940Efs*15 is a novel mutation which extends the MYH9 mutation spectrum.The loss of the S1943 phosphorylation site and the change of the charge status of the non-helical tail domain may be the potential molecular mechanisms of the MYH9 p.G1940Efs*15.