Study On The Mechanism Of Radiation-Induced Small Intestinal Injury Based On Single-Cell Transcriptome Sequencing Technology

With the widespread application of nuclear technology in military,industry,medical therapy and other related fields,the risks of nuclear terrorist attacks,nuclear power plant leakage,and radiation accidents caused by improper use or storage are increasing.The body undergoing high-dose ionizing radiation generally develops acute irradiation syndrome,which can be divided into bone marrow type,intestinal type and brain type.The small intestine is highly sensitive to ionizing radiation,and high-dose（>10Gy）of whole body radiation or clinical radiotherapy for abdominal and pelvic tumors lead to different degrees of radiation induced intestinal injure（RIII）.However,the mechanism underlying the RIII has not been clarified yet,and effective diagnosis and prevention measures are still lacking.Thus,it is urgent to further explore the pathogenesis of RIII and discover potential targets and biomarkers to develop novel therapeutics.Single-cell RNA sequencing（sc RNA-seq）is a powerful tool for profiling and analyzing individual cell data,which is able to obtain the precise expression level and sequence of the transcriptome,making it possible to resolve rare and intermediate cell states that hardly observed at the bulk level.Using the 10x Genomics sc RNA-seq technology,we sequenced intestinal cells from normal,radiation-injured and recovered intestine,trying to profile the variation tendency of intestinal cell subtypes,and further discover cell subsets related to the development of damage,trying to reveal new targets for the assessment,prevention and treatment of RIII.Materials and Methods:1.Establishment of a mouse model of RIII:110 male wild-type C57BL/6J mouse were exposed to a single dose of 15 Gy abdominal radiation with ⁶⁰Coγray.The jejunum of mice were taken at 0,1,3,7,14 days after radiation for bowel weight,morphological analysis,immunohistochemistry,and TUNEL assay.The metrics includes physical conditions,bowel weight,inflammatory cytokines level,villus length,villus width,crypt depth,the number of crypts per length,and the number of TUNEL-positive and Ki67 positive cells.2.sc RNA-seq of intestinal cells:10cm jejunum segments from mice on day 0,1,3,7,14 after radiation were isolated into single cells,which subjected to 10x Genomics sc RNA-seq following the manufacturer’s recommendations.3.Analysis of sc RNA-seq data:3.1 Landscape of multicellular ecosystem in healthy and injured intestine by sc RNA-seq:Differentially expressed marker genes were calculated based on Wilcoxon rank sum test between cells from each cluster and all other clusters.Interrogation of canonical marker genes revealed different cell subsets in t-distributed stochastic neighbor embedding（t-SNE）.3.2Radiosensitivities of different cell subtypes in the intestinal ecosystem:Distinct radiosensitivities of each subset were assessed by calculating the ratio of proportions of cells in individual clusters between 1 day post radiation and control group.3.3 Distinct dynamics of different cell subsets during RIII:The changes in proportion of each subset at different time points before and after radiation were recorded to select specifically changing subsets in the development of RIII,especially key populations related to intestine damage,repair,and inflammatory response.3.4 The selection of markers in intestinal stem cells（ISCs）and macrophages subsets:Signature genes that specifically expressed in ISCs and macrophages subsets were selected as candidate marker molecules.3.5 Temporal and spatial dynamics of enterocytes in intestinal injury and recovery:Relative position of enterocytes along the villus axis was calculated based on the ratio of expression of landmark genes of enterocytes in different villus areas.The ligand-receptor（L-R）interaction analysis and gene set variation analysis（GSVA）of endothelial.To assess the roles of various cell types in the inflammatory response induced by irradiation,L-R interaction analysis and GSVA were applied to assess cellular interactions among the cell clusters.3.7 GSVA of macrophage and enterocytes subsets:the GSVA was applied to detect the differentially enriched pathways in Macrophage subsets,aiming to assess the relative pathway activity on the level of individual cells,4.Verification of the finding from sc RNA-seq:4.1 Functional analysis of macrophage subsets:Changes in the proportion of pro-inflammatory and resident macrophage were recorded by flow cytometry.Cytokine secretion level of different macrophage subset was measured by radioimmunoassay,which helped to explore the effects of macrophage subsets in the development of RIII.4.2 Verification of the function of radiosensitivity-related genes:Three si NA interference sequences of Arl6ip1gene were designed and transfected into RAW264.7 cells.The changes in DNA damage and apoptosis after radiation after knock-out of Arl6ip1 in cell lines were assessed by flow cytometry and immunofluorescence.4.3 The dynamics of CD3⁺T cells during RIII assayed by immunohistochemical staining.Results:1.The phenotypic characteristics of mouse model of RIII:the mortality rate of mice within 14 days after 15 Gy abdominal radiation is 20%.In the first day post radiation,the villus length,villus width,crypt depth,numbers of crypts per length and cell proliferation were all decreased,and the number of apoptotic cells increased significantly especially in crypts,which led to cavitation in several crypts.3 days post irradiation,the villus length,crypt depth,and numbers of crypts per length continued to decrease comparing with that in 1 day post radiation group.Apoptotic cells decreased,while the proliferation restored and inflammatory cells infiltrated in the intestinal mucosal.The level of pro-inflammatory cytokines（TNFα,Il1,Il6）in the jejunum increased significantly,and the secretion of anti-inflammatory cytokines（Il10）decreased.The proliferation in crypts increased and the villi-crypt structure gradually recovered during 7-14 days post radiation.2.Results of sc RNA-seq analysis:2.1sc RNA-seq provided a landscape of multicellular ecosystem in healthy and injured intestine,which identified a total of 54 cell subsets belonging to 11 categories,including5 stem cell subsets,15 enterocytes subsets,7 T cell subsets,4 macrophage subsets.2.2Distinct radiosensitivity of different cell subsets in jejunum:Radiosensitive cells mainly included ISCs,T cells,macrophages,B cells,etc.Epithelial cells,stromal cells and most enterocytes showed lower sensitive to radiation.Distinct subsets of same cell type exhibited quite different sensitivity for radiation.Notably,a number of pathways,including PI3K/AKT/m TOR signaling,MYC signaling,TGF-βsignaling and cell cycle-related pathways,were consistently downregulated in surviving cells of different cell types,while KRAS-down signaling pathway were consistently upregulated in surviving cells.We identified 67 significantly upregulated genes that were shared by all the major cell types（Fabp1,Arl6ip1,Ckmt1,Ghrl,Hspa1b,Ccng1）.2.3 The distinct distribution of different types of cells.Among all 11 types of small intestine cells,T cells accounted for the highest proportion with 26.69%,epithelial cells accounting for22.83%,myeloid cells accounting for 12.96%,and stem cells accounting for 10.68%.There are also great differences in the proportion of different cell types at different stages before and after irradiation.2.4 Dynamics of macrophage subsets.Macrophage subsets were classified into pro-inflammatory macrophages and resident macrophages according to their functions.Pro-inflammatory macrophages were specifically enriched at 3 days after irradiation,and resident macrophages were specifically enriched at 7days after irradiation.2.5 Spatial reconstruction of enterocytes revealed the position and trajectory of different subsets along the villus-aixs.2.6 A positive feedback loop between the macrophages and endothelial cells amplifies inflammatory response upon RIII.Activated endothelial cells expressed high levels of adhesion molecules such as Vcam1 and Icam1,to recruit pro-inflammatory macrophages.Endothelial cells also expressed high levels of chemokine Cxcl12 to recruit pro-inflammatory macrophages.Pro-inflammatory macrophages expressed high levels of vascular endothelial growth factor（Vegf）,which in turn,enhance the endothelial cell survival and proliferation.GSVA revealed that activated endothelial cells at day 3 post irradiation were shown to be upregulated in inflammatory response,TNF-αsignaling via NF-κB,EMT and KRAS signaling pathways,which could induce the expression of cytokines in inflammatory response and promoted epithelial-to-mesenchymal transition.2.7 GSVA of macrophagy and enterocytes.Ly6c⁺monocytes were more active in the inflammatory response-related pathways,suggesting that this subset was undergoing a state of inflammatory activation,relateing to the intestinal inflammatory response.In pro-inflammatory macrophages,the expression of genes downregulated by Kras activation was increased.Immature enterocytes highly expressed cell proliferation and apoptosis-related pathways,suggesting that immature enterocytes obtaied a certain proliferation activity.Mature enterocytes were involved in inflammatory response pathways.3.Changes in functional subsets that related to radiation intestinal injury:3.1The ratio of total macrophages and pro-inflammatory macrophages both increased significantly at 3 days post radiation.Pro-inflammatory macrophages secreted higher levels of pro-inflammatory cytokines,like TNFα,Il1,Il6,while the resident macrophages secreted a higher level of the anti-inflammatory cytokine Il10.3.2 The expression of Arl6ip1in jejunum decreased significantly on 3 days post radiation,while showed no significant difference on1,7 and 14 days post radiation.The expression of Arl6ip1canbeeffectivelyinhibitedbyArl6ip1-si RNA-565（GGCTTGGGTGGGACAGCAAGT）in IEC-6 cells.Downregulation of Arl6ip1promoted the radiation-induced DNA damage,but inhibiting the proliferation of IEC-6cells.3.3 The number of CD3+T cells decreased significantly at 1 day post radiation,following a recovery at 3 days post radiation,and reached the peak at 7 days post radiation.Conclusion:1.Sc RNA-seq provided a comprehensive dynamic landscape of the cellular microenvironment during radiation induced intestinal injury and regeneration.2.Diverse cell subtypes in the intestinal microenvironment exhibited highly heterogeneties of radiosensitivity.Arl6ip1 can regulate radiosensitivity of intestinal epithelial cells.3.The interactions between the activated endothelial cells and pro-inflammatory macrophages could achieve a quick amplification of inflammation upon the RIII,which was critical for the quick induction of inflammation at early stage of intestinal injury.Inflammatory response was upregulated in activated endothelial cells at day 3 post irradiation,which could enhance the recruitment of pro-inflammatory macrophages.4.Pro-inflammatory macrophages（CD45⁺F4/80⁺CD11c⁺CD14⁺）were specifically enriched in the inflammatory phase after irradiation,secreting higher levels of pro-inflammatory cytokines and promoting the intestinal injury.