| Objective: Osteoarthritis is a disease regulated by inflammation and metabolic factors,which is characterized by progressive deterioration of cartilage,synovial inflammation,osteophyte generation and subchondral osteosclerosis.Currently,the etiology and disease progression mechanism of OA remain unclear,which limits the development of effective treatment.More evidence shows that,By interacting with a variety of m6 A regulators,m6 A modification is critical for inflammatory responses.Our aim is to identify the expression of RNA N6-methylation associated gene proteins associated with OA and to search for novel biomarkers and molecular targets to guide the treatment of osteoarthritis.Methods: The experimental groups were divided into normal control group and arthritis group.There were 10 rats in each group,According to the above experimental groups,on the first,third and fifth days of the experiment,the groups were injected into the right knee cavity with a mixture of 4% papain and 0.3mol/L L-cysteine 0.25 m L/kg.After modeling,If symptoms such as swelling,flexion and extension dysfunction,skipping,dragging,and reduced activity appear within 48 hours,the modeling is considered successful.2 days after the successful modeling,the rats were killed,and the articular cartilage tissues were taken for HE staining and toluidine blue staining.m6 A RNA methylation quantitative detection kit(colorimetric method)was used to detect the level of m6 A in each group.q PCR mi RNA-145-5P(GUCCAGUUUUCCCAGGAAUCCCU),METTL3(NM＿019852.5),METTL14(NM＿020961.4),YTHDC1(NM＿133370)and YTHDC2(NM＿0228)were detected in each group 28.5),ALKBH5(NM＿017758.4),FTO(NM＿001080432.3);The protein expression levels of METTL3,WTAP,METTL14 and KIAA1429 in each group were detected by WB.Results: According to the results of HE staining,the surface of cartilage in the normal group was smooth and smooth with clear structure and complete tidal line.In the model group of osteoarthritis,the surface cartilage showed severe fibrosis and degeneration,the cartilage layer became thinner,and some of the cartilage was seriously damaged,resulting in uneven cartilage surface and vertical fissures.According to the toluidine blue staining results,in the normal group,the cartilage was dark blue,and the subchondral bone was light blue.Compared with the normal group,in the osteoarthritis model group,the coloring ability of cartilage was significantly decreased,the number of chondrocytes was reduced,the bone trabecula was significantly thinner,fractured,the continuity was interrupted and the arrangement was loose.According to the quantitative detection results of m6 A RNA methylation,compared with the normal control group,the methylation degree of m6 A in the model group was significantly decreased and had a significant difference(P<0.05).According to the q-PCR results,compared with the control group,the expressions of ALKBH5,FTO,METTL3 and mi RNA-145-5P in the model group were significantly decreased(P<0.05).The expressions of METTL14 and YTHDC2 were significantly increased(P<0.05).According to the results of WB detection,the expression level of KIAA1429 decreased in the model group compared with the control group.The expressions of WTAP,METTL3 and METTL14 were increased,and WTAP and METTL14 had significant differences(P<0.05).Conclusion: Osteoarthritis damages the structural integrity of articular cartilage and reduces chondrocytes.Bone trabeculae become thinner,fractured,discontinuous and porous,and lead to decreased methylation level of m6 A and gene expression of ALKBH5,FTO,METTL3 and mi RNA-145-5P.The expressions of METTL14 and YTHDC2 genes were significantly increased,while the expressions of KIAA1429 protein were decreased,while the expressions of WTAP and MMETTL14 protein were increased... |
PDF Full Text Request