Identification Of The Core Region From The TsVP Promoter And Functional Analysis Of Its Upstream Regulation Proteins

It is meaningful to obtain more in-depth understanding of the molecular mechanisms of abiotic stress responses in higher plants. Arabidopsis is a salt-sensitive plant. It has some limitations in the salt and drought tolerance mechanism research. Thellungiella halophila, the relative species of Arabidopsis thaliana, is a highly salt-tolerant and drought-tolerant plant. It has the advantages such as having a small genome and sharing high cDNA sequence similarity with Arabidopsis. It is now becoming the model plant for the study of the plant stress response mechanisms.Regulation of gene expression could occur in the chromosome, transcription, post-transcription, translational and post-translational levels. Especially, the regulation in the transcription level is more important. Promoters containing the cis-acting elements play a very important role in the regulation of the gene transcription and the role of this regulation requires the participation of the upstream transcription factor proteins. In this study, the TsVP gene promoter from Thellungiella halophila was studied in detail. The identification of the core promoter region and the functional analysis of its upstream binding protein revealed parts of the salt stress response mechanisms of the TsVP gene.Gao et al found the TsVP and AVP1 genes had different expression profiles under salt stress condition although they had the same salt stress tolerance function in both the yeast and tobacco. The TsVP was salt stress inducible while the AVP1 was not. In order to investigate the reasons, we cloned and analyzed the promoter regions of these two genes, the result indicated that the categories, number and distribution of the cis-acting elements in these two promoters were different.Seried of 5'-deleted promoter-GUS mutants were constructed and transformed into Arabidopsis to study this promoter in detail. For the full-length TsVP promoter (2200bp), it could drive the expression of GUS reporter gene and its activity was almost the same as the well used CaMV 35S promoter under normal condition. While treated with salt stress, its activity was obviously induced up to about 3-fold level both in the leaves and roots. PT1 and PA1 had similar expression pattern under normal condition, but the activity of PT1 was induced especially in the root tips while PA1 was not. PT1 had strong activity in almost all the tissues except the seeds. All these results indicated that this promoter had a bright application prospect in the plant genetic engineering.By analyzing different 5'deletion mutants of the TsVP1 promoter, we found the activity of PT2 was much less than PT1. A 856bp region (-2200 to-1344) was found to contain enhancer element that increased gene expression levels. Two AAATGA motifs, which may be the key elements for the anther specific expression profile, in the deleted TsVP1 promoters (PT2 to PT6) were also identified.A 130bp region (-667 to -538) was finally identified which may be the key sequence for the salt stress response by analyzing the different mutants both with and without salt stress. Agrobacterium-mediated GUS transient assay in tobacco leaves suggested that this 130bp region was sufficient for the salt stress response. Bioinformatic analysis also revealed that there may be novel motifs in this region that were the key elements for the salt stress responsive activity of the TsVP1 promoter. Therefore, further research on this region would be important to reveal the salt stress response mechanism of this promoter.Using this 130bp region as the bait, we identified two proteins which could bind to this region by a yeast one-hybrid system. The two proteins were named as TsNacl and TsVOZ1, respectively.TsNacl has a ORF with 918bp length and share about 86% similarity with RD26 (AT4G27410) in the nucleotide level and 92% similarity in the amino acid level. RT-PCR results indicated that TsNacl was induced by salt, drought and ABA treatment, although there was some differences in the fold change levels. First, its expression in the roots was much less than the leaves under normal condition, but the change folds after stress treatment in the roots was much more than leaves. Second, it was sensitive to ABA treatment, especially in the roots. Its expression could increase to 1000-folds after 12 hours of ABA treatment. In contrast, its expression was not sensitive to drought stress, especially in the leaves. These results showed that TsNacl may be involved in the response to salt stress in Thelhngiella halophila, and ABA was related to this response.The TsNacl protein was expressed in E.coli strain BL21 and was used in the EMSA experiment. The expressed protein could bind to the 130bp region in vitro and this binding was specific. Further study to reveal the relationship of TsNacl and its target genes would be of great importance.According to the EMSA experiment we know that TsNacl protein could bind to the 130bp region. RT-PCR results showed that the expression level of TsNacl could be induced by salt stress. All these results indicated that TsNacl may be the upstream TF we were looking for.In the subsequent experiment, we constructed the over-expression and RNAi constructions of these two genes and transformed both Arabidopsis and Thelhmgiella halophila to study their function in the plant salt tolerance. The increased expression level of TsNacl in Arabidopsis could increase the plant salt-tolerance while the decreased expression level of TsNacl could increase the salt-sensitivity of transgenic plants.Identifying the TsNacl binding sites in TsVP promoter could provide a valuable reference for understanding the plant salt stress response mechanisms, and it may also provide a useful promoter element for the plant genetic engineering. So it was meaningful to identify the TsNacl binding site in the TsVP promoter. Using excessive different non-labeled DNA to compete with the TsNacl protein binding DNA, we identified a 20bp sequence (GAATATACCATGGATAAGCA) which may be the protein binding site. This DNA sequence contains a CATG element. NAC family protein binding site was thought to be CACG, but Trans et al shows that the protein family in Arabidopsis also binds to a MYC-like CATGTG sites. We speculated that CATG may be the core sites for TsNacl protein binding, but the combination of several nucleotides around should also be needed. Further mutations combined with the EMSA experiment to find the specific binding of the protein sites will be important.Based on this analysis, we did some further research on TsNacl. The binding site in the whole genome of Arabidopsis was analyzed by CHIP-on-chip. The results showed that the protein could bind to the promoter region from 284 genes in Arabidopsis. These 284 genes involved in many biological processes, including metabolism, development, localization, stimulus response, reproduction, protein phosphorylation, redox and the regulation of biological processes. It was noteworthy that in these 284 genes, about 70 genes encoded transcription factors, accounting for 25%, while the proposed Arabidopsis transcription factors represent only about 5% of the number of all the genes. This meaned that in the TsNacl target genes, the transcription factors share ratio was around 5 times of the normal ratio, and its target genes included some well studied genes such as the DREB gene that was recognized as stress tolerance-related transcription factors. This also showed that TsNacl genes played an important role in plant stress tolerance. TsNacl could control the expression of functional genes by direct regulation or through some little molecular transporters, structure protein or binding protein. This result indicated this transcription factor may be a key protein in the regulation net and it may have a rather upstream position. In addition, AVP1, the TsVP homologous gene in Arabidopsis was not included in these target genes. According to the previous promoter analysis, we know AVP1 was not induced by salt stress although it was related to stress resistance. The results showed that the TsNacl was not involved in the AVP1 gene regulation, which was consistent with our expectation.In addition, we also identified another protein TsVOZ1 which could bind to the bait plasmid based on the sequence of TsVP promoter in yeast. TsVOZ1 shared about 85% necleotide similarity and 90% amino acid similarity with AVOZ1. Its expression was induced by salt stress, but not by drought or ABA treatment. And the change folds were much less than that of TsNacl. According to the research results of Mitsuda et al., we found a "GCGTCGGCTGCACGC(-274 to-259)" sequence in the TsVP promoter region which may be the binding site of TsVOZl protein. This sequence was not included in the 130bp region we identified before. Changing the expression level of TsVOZl did not change the salt tolerance of transgenic Arabidopsis. This result indicated that TsVOZ1 could bind to the TsVP promoter, but it was not involved in the salt stress response regulation of this gene.In this study we analyzed the function of TsVP promoter and its upstream binding protein. This result would provide new cis-elements and salt-tolerant genes for plant transgenic engineering and also important information for further understanding of the difference in the salt-tolerance machanisms between Arabidopsis thaliana and Thelhungiella halophila.