Borealin is a new chromosomal passenger that may take part in the cell division and the attachment of chromosomal passenger complex to the centromer.ChIP on Chip is new method based on the chromosome immune precipitation and gene chip.ChIP(Chromosome immune precipitation)is a good technology to find how the transcription factor and DNA binding protein bind to the genome.But we cannot use the method to identify the binding sites on a large scale.Characteristic of chip is treating the samples on a large scale.So,the ChIP on Chip is an excellent technology to understand the function of transcription factor on a chromosome-Wide.In this study,we applied the technologies of RT-PCR,Western blot, antibody blocking,ChIP on Chip and luciferase report gene systems to study the function of the Borealin.We identified the differentially expressed in ES cells,multi-tissues and the early embryos.We also found the ability of Borealin binding DNA,scanned the binding sites of it on chromosomes 10,13,14,17.Some genes were screened out as the potent down-stream genes of Borealin.Knockdown the expression of Borealin inhibited the expression of these genes and over-expression of Borealin can promote the activity of their binding sites.Our study contained three parts.Experimental methods and results were as follows: Part 1:The expression of Borealin in mouse multi-tissues ES cells and early embryosThe RT-PCR results showed that the expression level of borealin in the undifferentiated hES cells was higher than that in the differentiated hES cells and there was no expression in the human embryonic fibroblasts cells.Borealin was also highly expressed in mouse pre-implantation embryos at 1,2,4,8-cell stages and blastula.To examine whether expression of borealin in ES cells is related to the undifferentiated status of the ES cells,the hES and mES cells were treated with 0.1 1M retinoic acid and the protein levels of Borealin, Survivin and Oct-4 were determined by Western blot.The results demonstrated that the protein levels of Borealin,Survivin and Oct-4 were remarkably decreased when the hES cells were induced into differentiated hES cells.The same results for Borealin were observed in the mES cells.Whole-mount in situ hybridization was performed to detect the expression of borealin in the 8.5-9.5 dpc mouse embryos.The results of in situ hybridization showed that Borealin was detected in the whole body of the embryo except the gut region,but the strongest signals were in the brain. Part 2 The anti-Borealin antibody arrested the early development of the mouse embryosIn order to determining whether Borealin plays a unique role during the early embryo development,the rabbit anti-Borealin antibody was microinjected into the mouse zygotes with rabbit IgG as the isotype control.Six hours later,the majority of the embryos developed into the 2-cell stage embryos without obvious difference between the embryos injected with the anti- Borealin antibody and IgG.At 48 h up to 72 h after microinjection,most embryos derived from the zygotes injected with the anti-Borealin antibody were arrested at the 2-cell or 4-cell stage,whereas, more than 75%embryos derived from the zygotes injected with IgG developed into morula at 48 h aftermicroinjection and the embryos further developed into blastula at 72 h.There were significantly differences between the two groups except at 2-cell stage P<0.05.All data were analyzed using SPSS 10.0 software.Differences of P<0.05 are considered statistically significant.In order to elucidate the mechanism underlying thedevelopment arrest of early embryos by injection of anti-Borealin antibody,the mitotic spindles of the zygotes were detected using indirect immunofluorescence. In the zygotes injected with IgG,normal spindles were observed,whereas in the zygotes injected with the antibody against Borealin the chromosome-spindle complex was disturbed and the chromosomes could not align at the equator plane of the mitotic spindle.The zygotes injected with the IgG displayed normal mitotic division,whereas the zygotes injected with anti-Borealin antibody were arrested at 2-cell or 4-cell stages with two or more nuclei in the individual cells,suggesting that Borealin plays crucial roles during the mitosis and cell proliferation Part 3 Research of Borealin binding DNA and finding the binding sites of Borealin on genome with ChIP on ChipUsing the ChIP on Chip,we found 448 sites on the chromosomes 10,13,14,17.There are 137 binding sites on the chromosome 10,83 sites on chromosome 13,115 sites on chromosome 14,83 sites on chromosome 14 and 113 sites on chromosome 17.The data were treated with MEME - Motif discovery tool and the motif ACTCCCAGCTTCAA GGGAGGCTGAGGCCTGAGCCTCCCTAGAAGCTGGGA were found. We found 35 potent downstream genes of Borealin based on the bio-imformatic analysis,8 on chromosome 10,3 on chromosome 13,6 on chromosome 14 and 18 on chromosome 17.In order to check whether Borealin binds to these sites,binding sites were identified by the chip with the MCF-7 cell and human ES cells. Binding sites of CBX4,7HSD,CDKN3,EIF4BP2,IPO4,WAC,TOB1, Survivin were selected to be checked.The results showed that Borealin can bind to these sites both in MCF-7 and human ES cells.With the knockdown of Borealin in MCF-7 cells,expression of 17HSD,CBX4,TOB,CDKN3 and Survivin fell down significantly.But there were no obviously change with the genes WAC,EIF4EBP2, RPS6KA5.The binding sites were cloned into the vector of PGL3-Basic and the pcDNA3.1-Borealin were co-transfected to the MCF-7 cells with the recombinant plasmids.Results showed that over expression of Borealin promoted the transcription of the reports gene.It is indentiffied that Borealin caon activate the promoter of these genes.In conclusion,we have indicated for the first time that Borealin is differentially expressed in undifferentiated and differentiated ES cells and plays crucial roles in the early development of mouse embryos.It is highly expressed in the testis ovary and the brain of the 8.5-9.5dpc mouse embryos.Borealin binds to the promoters of the CBX4,CDKN3, EIF4BP2 and 17HSD genes.All these results indicated that Borealin,as a new chromosomal passenger can bind to the DNA sequences and can promote the transcription of genes.In this study,ChIP on Chip was used to find binding sites on the chromosomes 10,13,14,17 for the first time. Based on the ChIP on Chip,we identified that Borealin can bind the DNA and the potent down-stream genes of the Borealin and the conserved binding motif of it were found.
|