As we all know, more and more mutations of genes were involved in occurring and progressing of malignant tumors, and most research were focused on nucleus genes. Recently, mitochondrial DNA (mt DNA) , an important group of gene outside nucleus, has become a hotspot in oncology. When mutagen exists, mt DNA is more easily to change than nucleus gene.How to make the mutations be helpful to clinic is an important question for scientists. Recently, it was found that some nucleus DNA could be detected in body fluid, but the positive rate was low partly because of being diluted by normal DNA. The mtDNA have two differences from nucleus gene. Firstly, mt DNA is lack of the repair mechanism for aberrant DNA, and due to that, it may suffer from environment factors prior to nucleus DNA and mutations would exist for a long time. Secondly, the copies of mt DNA are more than nucleus DNA, and could be easy to be detected. So by detecting mt DNA mutations in body fluid we could scan, diagnose or evaluate tumors.HV1 gene ( hypervariable segment I) locates in noncoding region of mtDNA. It is through noncoding region that transcription and translation of mRNA are controlled by nucleus gene . More mutations has been known to locate in HV1, So HV1 maybe a key control position and be closely related to tumor.This article includes three parts: 1. HV1 gene, hypervariable region 1 of mt DNA (16024 - 16383 ) , was detected for studying the roles in gastric carcinoma and bladder carcinoma. 2. HV1 was detected in body fluid comparing with in tissue to evaluate this new potential method to diagnosis. 3. In the same way, P53 was detected . we compared the difference in positive rate between the nucleus DNA and mt DNA.Materials and Methods1. Main Apparatus: Gene PCR Ampthermocycler, high speed centrifuge ( FISHER X General electrophoresis system( GIBCO BRL) ,UV - VIS Spectro-photometer ( BECKMAN ), D - Gene electrophoresis ( BIO - RAD ) ABI PRISM?77XL DNA Sequencer.Main Reagents: GOLD Taq polymerize enzyme ( ROCHE ),12mM dNTP (GIBCO BRL) ,TEMED,acidamide propylene,PCR amortize .2. methods.Patients and samples: 60 patients with malignant tumor were investigated, including 30 cases of gastric carcinoma ( 9 in stage T2, 16 in T3,5 in T4) and 30 cases of bladder carcinoma ( 3 in II stage, 18 in III ,9 in IV). 10ml vena blood sample was took out and anticoagulated with EDTA before operation , then lymphocytes and plasma were obtained by centrifuge. All the samples were preserved at -20. In addition, 50 ml of urine samples of the patients with bladder carcinoma were kept in the same conditions. All tissue specimens were took and put into liquid nitrogen immediately in operation. Gastric adenocarcinoma and bladder transitional cell carcinoma were confirmed by pathological physician. 60 normal tissues and its corresponding lymphocytes were chosen as control group.3. DNA Extracted and PCR amplificationDNA in tissues was extracted by the standard hydroxybenzene alcohol method. DNA in plasma and urine were obtained by using QLAmp Blood Kit ( Qia-gen , France ) ,50 l DNA could be got form 1 ml of plasma. PCR primersHV1: 5' - CACCATTAGCACCCAAAGCT - 3' and 5' - TGATTTCACGGAG-GATGGTG-3'.Amplification conditions were 95 for 10 min ; then for 30 cycles to amplify 95 30 sec, touchdown 55 30sec, and 72 60 sec .P53: exon 5: 5'- AGGAATTCACTTGTGCCCTGACTT and 5' - GAG-GAATCAGAGGCCTGGG;exon 6: 5' - TGCCCCAGGCCTCTGATTC and 5'-CATCGAATTCCACTGA-CAACCACCCTT;Amplification conditions were 951 for 10 min ; then for 40 cycles to amplify 95 30 sec, touchdown 63 60 sec , and 7 60 sec .4. SSCP: PCR products were diluted with 2 volumes of loading buffer, heatdenatured at 98 for 10 min ,and rapidly cooled on ice before loading; E-lectrophoresis was conducted at 40 Am of electric current for 3 hours. Sequencing analysis: PCR products were purified and do the sequencing by ABI PRISM?77XL DNA Sequencer using the same primers of the PCR reaction.Results1. By detecting mt DNA by SSCP, 13 mutations of HV1 g...
|