| In ordor to determine the polymorphism of IRS-1 gene 5 ' -UTR, -898bp-+5bp region of IRS-1 gene 5'-regulatory region of 76 subjects with Type 2 diabetes and 78 healthy controls were studied by using polymerase chain reaction (PCR) , single strand conformation polymorphism(SSCP) assay and denaturing polyacrylamide gel electrophoresis and AgNO3 staining techniques. The variant and the wild-type subjects were amplified from genomic DNA by PCR using a pair of primers and pfu DNA polymerase. The distal primer CGCGCAAGCTTCTCCACCCGCCGGGGAGATCCCGGATG was constructed with Xba I restriction site, and the proximal primer CGCGCTCTAGAAGTCCCAACGTTGCACGGGGTTCTCCCTC was constructed with Xba I restriction site. After purification, the PCR products were digested with Xba I digestion, then use T4 DNA ligase, directionally insert the digested PCR fragments into the pGL2 promoter vector digested Sma I /Nhe I , and transformated the reaction solution to E.Coli.DH5 . The positive clones were random selected and cultured overnight. Use alkaline lysis method to extract the plasmid DNA. DNA constructs were identified by Pst I /Bgl II digestion, denaturing polyacrylamide gel electrophoresis and DNA sequence analysis. Six alleles(T1-T6) and 7 genotypes were obtained , Six alleles(T1-T6) and7 gene types were obtained , T1-T6 were termed according to their mobility on denaturing polyacrylamide gel. Constructs containing alleles were named as pGL2 promoter-T1 to pGL2 promoter-T6.To study whether the repeat number variation of trinucleotide repeats has an influence on the gene expression level, T5( found in 2 patients, lack continuous 3 CAG copies) and wild-type T3 were used in the function study. The promoter reporter gene constructs pGL2 promoter T3 and T5 obtained were used to transiently transfected to Hela cells together with pSV- P -Galactosidase control vector( 3 -Gal).Luciferase(luc) activities were assayed by counting the .The activities of -Gal was measured in spectrophotometry and represented in milliunit. The expression level of regulatory sequences were determined.In order to further study the abnormality mechanism of gene expression in transcription regulation level, using WT regulatory sequence T3 and T5(3 CAG copies absent) as study subjects, we apply electrophoresis mobility shift assay and DNA footprint techniques to investigate the interaction between the regulatory region and hela cells nuclear extracts.Results:1 Six alleles(T1-T6) and seven gene types (T1/T1 , T1/T3, T2AT3,T3/T3, T4/T3, T5/T3 T6/T3)were detected ,T5 and T6 were only found in Type 2 diabetes patients.2 The frequency of allele T1-T6 in the control group were 0.0641,0.0064,0.9103,0.0192,0,0 and The frequency of Type 2 diabetes group were 0.0658,0.0076,0.8949,0.0132,0.0132,0.0066; No significant difference was shown between the 2 groups(P>0.05).3 The frequency of 7 gene types were 0.846,0.026,0.077,0.013,0.038,0,0 and0.817,0.026,0.079,0.013,0.026,0.013 in the control group and Type 2 diabetes group, respectively. No significant difference was shown between the 2 groups(P>0 05).4 The relative activities of wild-type allele T3 and the deletional T5 of IRS-1 gene were 9.98% 1.40% (n=5)and 7.76% 1.05%(n=5), respectively. The activity of deletional T5 regulatory sequence decresed as 22.2% compared to the wild-type allele T3.5 The wild-type and deletional regulatory sequence can bind to nuclear protein extracted from Hela cells, and form single DNA-protein complex with same mobility on the polyacrylamide gel electrophoresis.6 DNA footprint prove: There are 2 same protein binding sites in the 2 regulatory sequences. The binding sequence are: cgcgcccgcgggcggcggc and gggcggctggtggcggctg.Conclusion:1 . Denaturing polyacrylamide gel electrophoresis of PCR products is more sensitive than PCR-SSCP in the study of the length polymorphism.2 There are 6 alleles in IRS-1 gene 5'-UTR.Among them, T1, T2, T4, T5, T6 were five deletion/insertion variations.
|
PDF Full Text Request