Font Size: a A A

Study Of PreS2 Mutations And HBV Specific Circulating Immune Complex In Severe Hepatitis B

Posted on:2004-04-05Degree:DoctorType:Dissertation
Country:ChinaCandidate:W WuFull Text:PDF
GTID:1104360092990631Subject:Internal Medicine
Abstract/Summary:PDF Full Text Request
Part one: Study of genetic mutations of hepatitis B virus preS2 region in serum offulminant hepatitis B patientsThe role of fulminant hepatitis remains unknown. Recently, more and more proofs showed that it might relate with the genetic mutations of HBV, such as pre-core region, core promoter and pre-S2 and so on. But no specific mutation is responsible for the deterioration of the disease till now. We study the preS2 regions mutations in 25cases of fulminant hepatits B and 20 case of chronic hepatitis B in Zhejiang province, southeast of China, in order to find some relationship between of pres2 mutation and fulminant hepatitis or chronic hepatitis. Materials and methods:Patients: 25 cases of fulminant hepatitis (Numbered as FH) aged from 25 to 56, 21 cases were male and 4 were female. Among them, FH (1) and FH (S24) were without previous hepatitis history; the other 23 were with previous hepatitis history. 20 cases of chronichepatitis (Numbered as C) aged from 20 to 52, 15 cases were male and 5 were female. All the patients were admitted in our hospital from 1999 to 2002. The diagnoses were proved by clinical data or liver biopsy. The serums HBV DNA were positive in all these patients. The serum markers of HAV, HCV, HDV, HEV, EBV and CMV were negative in these patients. The serum samples were kept at -20 癈 before DNA extraction. Methods: The serum HBV DNA was extracted with phenol: chloroform (1:1). The nucleotide sequences of the primers used were as follows: sense primer, SPS2, 5TCAGGCTCAGGGCATA3'(nt 3092-3107), and the antisense primer, ASPS2, 5'AACCCCGCCTGTAACACGAG 3' (nt 193-212) . The total volume of PCR reaction was 50ul, including 1ul dNTP(lOmM), 5ul 10xbuffer(with Mg2+), 1.5ul SPS2 (10pmol/ul), 1.5ul ASPS2 (10pmol/ul), 0.5ul Tag( 5u/ul), 5ul template DNA, 35.5ul ddH2O. PCR was carried out at 95 C for 3 minutes, followed by 30 cycles of 95 C for 30 sec, 55 C for 30 sec, 72C for 45 sec, at last extending at 72 C for 7 min. The PCR products were purified with gel purification kits (Bioasia) and sequenced directly. The results were analyzed with DNAssist. Results2 cases of fulminant hepatitis and with previous liver disease had start codon mutations (ATG-ACT, ATG-ATA), whereas 3 cases of chronic hepatitis B mutated in this region ( ATG-ATA, ATG-GTG ) . 9 cases of fulminant hepatitis (9/25) and 2 cases of chronic hepatitis (2/20) (p<0.05) had some mutations such as point mutations or deletion from 30 to 49 amino acid, which was located in the T cell epitope region of preS2.The start codon of preS2 would mutate both in fulminant hepatitis and chronic hepatitis. Multi-point mutations or deletion were observed in the region of T cell epitope of preS2 in fulminant hepatitis and chronic hepatitis. DiscussionsThe pres2 region of HBV DNA has 165bp, coding 55amino acid of pres2 protein. The pres2 protein is essential for HBV to mature and secret from the infected cell. The start codon of pres2 is ATG. Mutation of start codon will cause the failure of synthesis of pres2 protein, which will lead to the unbalanced ratio of main, middle and large protein of HBV particles. It was believed to be one of the reasons of deterioration of liver functions. It was proved in the mouse model that the 30-55 amino acid of pres2 was a T cell epitope, while 14- 24 amino acid was a B cell epitope nearby.In our study, the result showed that 2 cases among 23 cases of fulminant hepatitis with previous hepatitis had start codon mutations (ATG-ACT, ATG-ATA),the other 2 cases of fulminant hepatitis without previous hepatitis had not found such mutation. At the same time, 3 cases among 20 cases of chronic hepatitis mutated at start codon (ATG *ATA, ATG-GTG) . Start codon mutation may occur both in fulminant hepatitis and chronic hepatitis.Our study also showed that 9 cases(9/25) of fulminant hepatitis and 2 cases (2/20) of chronic hepatitis mutated at the range from 30 to 49 amino acid(P<0.05). This range was located at the T cell epitope of pres2. Whether these mutations will cause the structure or...
Keywords/Search Tags:Circulating
PDF Full Text Request
Related items