一, Background and ObjectiveHuman ANGPTL4 gene is an angiopoietin-related gene discovered recently. Its protein is about 60kDa in size and consists of 406 amino acids. Recent studies showed human ANGPTL4 was expressed in human tissue in the following sequence: normal liver >noncancerous liver tissue>HCC. In addition, it is expressed at a very high lever in the placenta medium levers in the heart, liver, muscle, pancreas, and lung, while low levers in the brain and kidney. Human ANGPTL4 gene played a role to inhibit growth of HCC. In an earlier study, human ANGPTL4 gene was transferred into the cells by using the plasmid pCMV-Script under mediation of lipofectin regeant. The expression of human ANGPTL4 gene in the cells was instantaneous, and only last several days. The overall rate of human ANGPTL4 gene transfection mediated by lipofectin regeant was low. Therefore, in order to further investigate the anti-tumor effects of this angiopoietin-related gene and to explore a possibly effective strategy for liver cancer therapy, a stable human ANGPTL4-transfected human liver cancer cell line HepG2-ANGPTL4 was created by using retrovirus-mediated gene transfer.二, MethodsHuman ANGPTL4 cDNA was cloned in vitro from human normal liver cell HL-7702 by using RT-PCR, and then subcloned into plasmid vector pMSCV and sequenced. High-titer recombinant retrovirus pMSCV-ANGPTL4 and blank retrovirus pMSCV packaged under mediation of lipofectamine infected HepG2 cells in vitro, respectively. Flow cytometry and fluorescence microscopy detected expression of GFP (green fluorescence protein) in every HepG2 cells group. The expression of human ANGPTL4 mRNA in every HepG2 cells group was investigated by using RT-PCR. Nude mice forming tumors experiment and MTT test detected the growth of every HepG2 cellsgroup in vivo and in vitro, respectively.1. Cell culture293 EBNA, NIH3T3 and HepG2 cells were cultured in DMEM medium supplemented with 10% fetal bovine serum. HL-7702 cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum. All cells were cultured in 5% CO2 at 37℃.2. Gene amplificationTotal RNA was extracted from HL-7702 cells. One μg total RNA was reverse transcribed to synthesize a single strand cDNA product. The total length of the ANGPTL4 cDNA was about 1.2kb. Because it was too long to be amplified, the ANGPTL4 cDNA was divided into A and B segments for amplification from ss-cDNA using PCR. PCR was performed in 50 μl reactive volumes containing 2.5ng ss-cDNA, 5μl10 × PCR buffer, 1.5μl 10mmol/L dNTP, 3μl 10 μmol/L primer, and 0.5μl pfx DNA polymerase. Samples were subjected to 10 minutes at 94 ℃ for pre-denaturing, followed by 30 thermal cycles of 30 seconds at 94℃ for denaturing and 1.5 minute at 68 ℃ for annealing and extension, and an additional 5 minutes at 68 ℃ for final extension after the last cycle. The RT-PCR products were electrophoresed on a 2% agarose gel. A and B segments were digested with EcoR I , and then the resulting products were ligated with T4 DNA ligase. ANGPTL4 cDNA was designed to contain restriction sites Bgl II and Hap I at the 5' ends and 3' ends. The sequences of all primers used were as follows:A segment: F 5GGAAGATCTATGAGCGGTGCTCCGACGGC3 434bp Bgl IIR 5CTTTGCAGATGCTGAATTCGCAGGTGCTG3EcoR IB segment: F 5ACCTGCGAATTCAGCATCTGCAAAGCCAG3 830bp EcoR IR 5GGGGTTAACCTAGGAGGCTGCCTCTGCTG3 Hpa I3. Construction of recombinant retroviral plasmid vectorThe retroviral plasmid vector pMSCV (plasmid of murine stem cell virus) contains GFP gene. The GFP gene was used as a reporter gene to provide evidence of successful transduction and expression.of the foreign gene ANGPTL4. The retroviral plasmidvector pMSCV and ANGPTL4 cDNA were both digested with Bgl II and Hap and then the resulting products were ligated. The new recombinant plasmid vector containing human ANGPTL4 cDNA was designated as pMSCV-ANGPTIA The recombinant retroviral plasmid vector was identified by PCR, restriction endonuclease analysis and DNA sequence analysis.4. Packaging of recombinant retrovirusThe retrov...
|