Involvement Of Spinal T-type Calcium Channel In Neuropathic Pain In Rats

ObjectiveThe T - type of voltage dependent calcium channels ( VDCCs) are known to perform several roles in neurons such as, lowering the threshold for action potentials , promoting burst firing and oscillatory behaviour, enhancing synaptic excitation , and Ca～(2 +) - dependent gene transcription. Previous study had indicated that mibefradil may act on peripheral T - type Ca～(2+) channels in antinociceptive effects in neuropathic pain. The spinal cord plays an important role in the transmission and modulation of nociceptive information, and also the major mechanism of central sensitization in neuropathic pain. Therefore, it is essential to in-dentify the role of the T - type VDCC in neuropathic pain.With a well - defined chronic compression of dorsal root ganglia ( CCD) model of neuropathic pain, the purpose of present study was twofold: the first was to investiate the role of mibefradil, a T - type calcium channels inhibitor, on the development of allodynia and hyperalgesia in neuropathic pain in rats, the second was to explore the expression of three subtypes ( Ca_v3.1, Ca_v3.2, Ca_v3. 3) of T - type calcium channel in spinal cord in rats with neuropathic pain, as well as their roles in nociceptive information transmitsion by using antisense oli-godeoxynucleotide method, western Blot, RT-PCR, and behaveior test methods.Part OneEffects of Intrathecally Injection of Mibefradil, a T - type Calcium Channel Inhibitor, on Chronic Compression of Dorsal Root Ganglion Induced Neuropathic PainMaterials and Methods1. Chronic compression of dorsal root ganglion (CCD) model Experiments were performed on adult, male Sprague - Dawley rats weighting 230 - 300g. Rats were anesthetized with pentobarbital sodium. On the right side, the paraspinal muscles were separated from the mammillary process and the transverse process and intervertebral foramina of L4 and L5 exposed. A stainless steel rod, L - shaped, 3. 5 mm in length, and 0. 7 mm in diameter, was inserted approximately 4 mm into the intervetebrate foramen at L4, and a-gain at L5, at a rostral direction at an angle of 30 40 to the dorsal middle line and 10-15 below the vertebral horizontal. In sham operation group, only L4₅ transverse processes and intervertebral foramina were exposed but the L — shaped rod was not inserted.2. Experimental paradigm2. 1. Study oneTwenty four rats were divided into Naive group, Sham group, and CCD group ( n = 8). Mechanical withdrawal threshold ( MWT) using Von Frey filament and thermal withdrawal latency (TWL) using radiant heat applied to the plantar surface were measured before surgery (baseline) and 1, 3, 5, 7, 14 and 21 days after surgery .2.2. Study twoAccording to the different doses intrathecally administered, thirty - two male SD rats were divided into 4 groups ( n = 8) : NS group (normal saline) , Mib50 group (mibefradil 50|xg) , MiblOO group (mibefradil 100 fxg) , Mib200 group (mibefradil 200 jxg). Five days after CCD model was established, a bolus of normal saline or mibefradil (50, 100 and 200 jxg) in 10|x 10.9% NS was given IT. MWT and TWL were measured before CCD surgery (baseline) , before IT injection (pre - drug) or 30, 60, 120, 240 and 480 minutes after IT injection.3. Data analysis and statisticsData were expressed as mean SEM. The results were analyzed by analysisof variance (ANOVA) followed either by a multiple comparison test to compare the time course of anti - thermal hyperalgesia effect and of anti - allodynia effect or by t - test in an unpaired series to compare data obtained after drug administration. Values of P <0.05 were considered as statistically significant.Results1. Blockade of tactile hypersensitivityIn study one, the mean paw withdrawal thresholds of rats with CCD ranged from 3.6 ±1.2 to 3. 9 ±1.6 g after surgery, which were significantly lower than that in sham group. In study two, the IT injection of 50, 100 and 200 g mibefradil reversed tactile hypersensitivity in a dose - and time - dependent fashion. A peak effect of 12.4 ±3.1 g was obtained within 60 min after administration of the highest test dose of mibefradil (200 jxg)2. Blockade of thermal hyperalgesiaIn study one, the mean paw withdrawal latency of rats with CCD ranged from 9. 8 ±2. 1 to 15. 1 ±3.7 s after surgery, which were significantly lower than that in sham group. In study two, the IT injection of 50, 100 and 200 jxg mibefradil exerted a dose - dependent reversal of thermal hyperalgesia from 30min to 120min after surgical. A peak effect was obtained within 60 min after administration of the highest test dose of mibefradil (200 |xg) , as indicated by increased paw withdrawal latencies to 17.4 ±3. 8s.Part TwoExpression of T - type Calcium Channels Subtypes in Spinal Cord of Rats with Chronic Compression of Dorsal Root Ganglion Induced Neuropathic PainMaterials and Methods1. CCD model. The same as that in part one.2. Experimental paradigmEighteen rats were divided into Naive group, Sham group, and CCD group (n = 6). The expression of mRNA and protein of three T - type calcium channels subtypes (Cay3. 1 %Cav3.2xCaT3.3) in spinal cord were measured five days after CCD or sham surgery.3. Data analysis and statistics. The same as that in part one.Resuls1. The expression of CaT3.1 mRNA and protein in spinal cordThere was no expression of Cav3. 1 mRNA and protein in rats spinal cord a-mong all three groups.2. The expression of Cav3.2 mRNA and protein in spinal cordIt was seen the expression of Cav3.2 mRNA and protein in spinal cord a-mong all three groups, there were no significantly differences between naive group and sham group. Compared to sham group, rats in CCD group showed significant increase of Cav3. 2 mRNA (52% , P <0.01 ) and protein (120% , P < 0. 01) in spinal cord .3. The expression of Cav3.3 mRNA and protein in spinal cordIt was seen the expression of Cav3. 3 mRNA and protein in spinal cord a-mong all three groups, there were no significantly differences between naive group and sham group. Compared to sham group, rats in CCD group showed significant increase of Cav3. 3 mRNA (105% , P <0.01 ) and protein (150% , P <0. 01) in spinal cord .Part ThreeEffects of intrathecal administration of Cav3.2 antisense oligodeoxy-nucleotides on mechanical allodynia and heat hyperalgesia in neuropathic painMaterials and Methods1. CCD model. The same as that in part one.? 12-2. Oligodeoxynucleotides (ODNs)AS phosphorodiester ODNs were designed based on rat Cav3. 2 sequences ( GenBank nos. AF290213) in regions lacking known splice variants. Their sequences were as follows;AS - Cav3. 2, CCACCTTCTTACGCCAGCGG;Mis-sense, TACTGTACTTGCGAGGCCAC. A blast search revealed that the mis-sense ODN were not complementary to any registered nucleotide sequences.3. Implantation of intrathecal catheters (IT)A midline incision was made on the back of the neck. The muscle was freed at the attachment to the skull exposing the cisternal membrane. The membrane was opened with a stab blade and an 7. 5 cm polyethylene (PE - 10) catheter was then inserted through the cisternal opening, and passed carefully and caudally into the IT space at the rostral edge of the lumbar enlargement . The end of the catheter was tunneled through the s. c. space over the frontal bones, flushed with lOul saline, and then plugged with a short length of wire.4. Experimental paradigm4.1. Study one.At the fifth day after successfully implantation of intrathecal catheters, rats were divided into four groups ( n = 8) : Sham group, NS group, AS - OND group, and Missense group, which were intrathecally injected with normal saline (in Sham and NS group) , AS - OND (12.5|xg /rat) , and Missense OND (12. 5jxg /rat) respectively. This treatment was repeated twice daily for 4 days (days 1 - 4). MWT and TWL were measured before rod implantation (baseline) and again on postoperative days from 1 to 15.4.2. Study two.Five days after successfully implantation of intrathecal catheters, rats were divided into four groups ( n = 6);Sham group, NS group, AS - OND group, and Missense group, which were intrathecally injected with normal saline (in Sham and NS group) , AS - OND (12.5|xg /rat) , and Missense OND (12.5fxg /rat) respectively. This treatment was repeated twice daily for4 days (from 1 to 4 days). Lumbar spinal cord of rats were removed at the fifth day to detect the prelein level of Cav3.2.5. Data analysis and statistics. The same as that in part one.Results1. Effects of intrathecal injection of Cav3.2 AS - OND on MWT Compared with NS group, a significant increase in MWT was observed from3 to 7 days after rod implantation in Cav3. 2 AS - OND treated animals (P <0. 01). No difference was noted between animals injected with missense OND and Saline solution.2. Effects of intrathecal injection of Cav3. 2 AS - OND on TWL Compared with NS group, a significant increase in TWL was observed from3 to 8 days after rod implantation in Cav3. 2 AS - OND treated animals ( P <0. 01). No difference was noted between animals injected with missense OND and saline solution.3. Effects of intrathecal injection of Cav3. 2 AS - OND on protein expressionCompared to NS group, the expression of Cav3. 2 pretein in AS - OND group was significantly less ( - 51%, P<0.01). There was no effect on Cav 3.2 pretein after intrathecal administration of missense oligodeoxynucleotide.Part FourEffects of intrathecal administration of Cav3.3 antisense oligodeoxy-micleotides on mechanical allodynia and heat hyperalgesia in neuropathic painMaterials and Methods1. The animals and CCD model are as same as that in part one.2. Oligodeoxynucleotides (ODNs)AS phosphorodiester ODNs were designed based on rat Cav3. 3 sequences ( GenBank nos. AF290213) in regions lacking known splice variants. Their sequences were as follows: AS - Cav 3.3, GCTGAGGGCGGCTTGTGTTT;Mis-sense, TACTGTACTTGCGAGGCCAC. A blast search revealed that the mis-sense ODN were not complementary to any registered nucleotide sequences.3. Implantation of intrathecal catheters (IT). The same as that in part three.4. Experimental paradigmWe used the Cav3.3 AS - OND instead of Cav3.2 AS - OND in AS - OND group. Others were as same as that in part three.5. Data analysis and statistics. The same as that in part oneResults1. Effects of intrathecal injection of Cav3. 3 AS - OND on MWT Compared with NS group, a significant increase in MWT was observed from4 to 8 days after rod implantation in Cav3. 2 AS - OND treated animals ( P <0. 01). No difference was noted between animals injected with missense OND and Saline solution.2. Effects of intrathecal injection of Cav3.3 AS - OND on TWL Compared with NS group, a significant increase in TWL was observed from4 to 7 days after rod implantation in Cav3. 3 AS - OND treated animals ( P <0. 01). No difference was noted between animals injected with missense OND and Saline solution.3. Effects of intrathecal injection of Cav3. 3 AS - OND on protein expressionCompared to NS group, the expression of Cav 3. 2 protein in AS - OND group was significantly less ( - 40% , P <0. 01). There was no effect on Cav 3.2 pretein after intrathecal administration of missense oligodeoxynucleotide.Conclusions1. The intrathecally administration of mibefradil, a T - type VDCC block-ers, effectively suppresse thermal hyperalgesia and allodynia in neuropathic pain, in which suggested that T - type calcium channels may play a role in theexpression of the neuropathic state.2. In normal rats, their existed the expression of spinal CaT3.2 and CaT3.3 subtypes, but no Cav3.1 subtype.3. The expression of mRNA and protein of spinal Cav3.2 and CaT3.3 were up - regulated in the forming of chronic compression of dorsal root ganglia induced neuropathic pain.4. Intrathecal injection of Cav3.2 antisense oligodeoxynucleotide attenuated thermal hyperalgesia and allodynia in neuropathic pain, in which down - regulation of spinal Cav3.2 may involved.5. Intrathecal injection of Cav3.3 antisense oligodeoxynucleotide attenuated thermal hyperalgesia and allodynia in neuropathic pain, in which down - regulation of spinal Cav3. 3may involved.