Protection Of Heme Oxygenase-1 Recombinant Lactococcus Lactis By Gastric Perfusion On Intestinal Barrier In Rats With Hemorrhagic Shock

ObjectiveHemorrhagic shock ( HS) is the common complication of trauma and surgery. During shock, several compensatory mechanisms are activated to maintain blood flow to the heart and brain, which is associated with decreased mesenteric blood flow and damage of the intestinal mucosal barrier due to ischemia reperfu-sion (I/R) injury. It has become clear that the gut mucosa is highly susceptible to hypoxia or ischemia reperfusion injury, and disruption of the intestinal epithelial lining is associated with the translocation of bacteria ( BT) or bacteria - derived substances from the gut lumen into the bloodstream. Gut hypoperfusion has been implicated as an initiating event in the development of septic complications and gastrointestinal tract has been defined as the " motor of system inflammatory response syndrome ( SIRS ) and multiple organ dysfunction syndrome ( MODS) " . So more and more studies are focusing on the protection of intestinal barrier during hemorrhagic shock.Probiotics are live microbial food supplements or component of bacteria which have been shown to have beneficial effects on human health. Recen studies showed that probiotics could protect the intestinal barrier and decrease the endogenesis infection by stabilising the gut microbial environment. However, it is impossible to prevent the disruption of the intestinal barrier during severe infection , trauma and hemorrhagic shock by only using probiotics. Heme oxygen-ase (HO) is the rate -limiting enzyme in heme catabolism. So far, three distinct isoforms of HO (HO - 1, HO -2 and HO -3) have been identified. Recently it was reported that HO -1, the inducible isoform of heme oxygenase, is involved in the fundamental protection of mucosal epithelial cells of the rat intes-tine from oxidative damages that occur in sepsis. Therefore, in this study, we cloned the gene of rat HO - 1 and engineered an Lactococcus lactis ( a kind of probiotic) strain expressing biologically active rat HO - 1. Then we evaluated the effects of recombinant Lactococcus lactis on the intestinal barrier in rats with hemorrhagic shock anticipating to finding a new way to protect the intestinal barrier during hemorrhagic shock.Part OneCloning and sequencing of rat HO -1 geneMaterials and Methods1. Bacterial strains, plasmids, and DNA manipulations. Escherichia coli (DH5a) was grown in Luria - Bertani medium at 37 °C with vigorous shaking. pGEM - T Easy vector was purchased from Promega Corporation. Unless otherwise indicated, plasmid constructions were first established in E. coli by transformation.2. Isolation and analysis of total RNA. Total RNA of Sprague Dawley rat spleen was obtained by the Total RNA Isolation System ( Promega, USA) according to the manufacturer's protocol. The quantity of RNA was calculated by spectrophotometry.3. Cloning of full length cDNA of rat HO - 1. Acording to the sequence of rat HO -1, we designed 5'and 3'gene specifi primers. The segments were amplified using the following primers containing Nsi I and EcoR I restriction enzyme sites, synthesized by Shanghai Sangon Biological Egineering, Co. , Ltd. , Shanghai, China. The PCR primer sequences were as follows: PI, 5' C C A A TGCATATGGAGCGCCCACAGCTCG3';P2, 5'C G G A A TTC TTACATGGCATAAATTCCC3'. The full length cDNA of rat HO - 1 was cloned by reverse transcriptase and polymerase chain reaction (RT-PCR).4. Sequencing of rat HO - 1 gene. The sequencing of rat HO -1 gene was identified by T/A clone.Results1. Total RNA of Sprague Dawley rat spleen was obtained successfully and the isolated RNA had an A260/A280 ratio of 1.75.2. The full length cDNA of rat HO - 1 was cloned integrately.3. Sequence analysis showed that the sequenced fragment was the same as rat HO ?1 gene (012580) in the GenBank.Part TwoThe construction of pSEC - HO -1 and the expression of rat HO - 1 gene in Lactococcus lactisMaterials and Methods1. Bacterial strains, plasmids, and DNA manipulations. L. lactis (NZ9000) was grown in brain heart infusion at 30°C without shaking. pSEC -E7 was kindly endowed by Professor Luis. Unless otherwise indicated, plasmid constructions were first established in E. coli by transformation and then transferred into L. lactis by electroporation.2. Construction of recombinant plasmids and strains. The purified PCR product was directly cloned into pGEM - T Easy Vector ( Promega, USA) , resulting in pGEM - HO - 1 plasmid. After being confirmed by sequencing (Sangon, Shanghai, China) , pGEM - HO - 1 was digested with Nsi I and EcoR I (Promega, USA) and then recovered from agrose gel. The pSEC -E7 was cleaved by the same restriction enzymes and recover from agrose gel as the vector segment. Two recovered segments were ligated with T4 DNA ligase ( Pro-mega, USA) at 4CC overnight to give expression vector pSEC - HO - 1. The constructs were initially made in E. coli DH5a and then transferred to L lactis NZ9000 by electroporation ( Gene - Pulser H apparatus, Bio - Rad, USA ). The HO - 1 gene insert was verified by restriction analysis and DNA sequencing.3. Expression of HO - 1 in L lactis NZ9000 and measurement of HO - 1 activity. The expression of heme oxygenase - 1 gene induced by nisin was identified by SDS - PAGE and Western blot, and the activity of heme oxygenase - 1 secreted by engineering L. lactis was measured by spectrophotography.Results1. pSEC - HO - 1 was successfully constructed.2. The results of SDS - PAGE and Western blot showed that the rat HO -1 gene can be expressed in L. lactis , and its expression level was about 7.0 mg I"1.3. The activity of HO - 1 secreted by engineering L. lactis was 2. 386 units ? mg"1 ? h~'.Part ThreeProtection of heme oxygenase -1 recombinantLactococcus lactis by gastric perfusion on intestinalbarrier in rats with hemorrhagic shockMaterials and Methods1. Animals. Experiments were performed on adult, male Sprague Dawley rats weighting 250 ~ 300 g.2. Hemprrhagic Shock Model. The rats were fasted overnight, and anesthetized with intraperitoneal sodium pentobarbital. The femoral artery of each ratwas isolated by aseptic techniques and cannulated with polyethylene tubing. A three - way stopcock was attached in - line for withdrawing blood and for monitoring blood pressure. Blood was withdrawn into a syringe containing 10 units of heparin in 0. 3 mL of 0. 9% NaCl. The mean arterial blood pressure was reduced to 30 mm Hg and maintained at this level for the 30 - min shock period by withdrawing or reinfusing shed blood as needed. The shed blood was kept at 37 degrees C. The animals were resuscitated at the end of the shock period by rein-fusing all of the shed blood. The catheter was removed and the artery was liga-ted. The incision was closed in two layers.3. Preparation of bacterial cells for gastric perfusion. For induction of the nisin promoter, L. lactis strains were grown until the optical density at 600 nm was ~0.6, and this was followed by induction with 10 ng of nisin (Sigma) per ml for 3 h. After centrifugation, the cells were washed three times with sterile phosphate -buffered saline (PBS) before resuspension in PBS at 5 x 10 CFU/ ml.4. Experimental protocols. Thirty - two male SD rats were divided randomly into four groups: sham group ( sham, n = 8) , hemorrhagic shock group (HS, n = 8) , wild - type L. lactis group (LL, n = 8) and recombinant L. lactis group ( LL - HO, n = 8 ). The rats were treated with recombinant or wild- type L. lactis or with PBS by gastric perfusion for three days before hemorrhagic shock. At 24 hours after resuscitation, the animals were sacrificed and il-eum was sampled for the determination of bacterial translocation and the contents of HO - 1 and malondialdehyde ( MDA). The morphological changes of ileum were also observed.5. Data analysis and statistics. The occurrence rates of translocation was e-valuated by chi - square analysis with the Yates correction. Continuous data were analyzed by one — way analysis of variance. Differences between the four groups were determined with the post hoc Newman - Keuls'test. A p less than . 05 was considered significant.Results1. Bacterial translocation. Rats subjected to 30 mins of hemorrhagic shockhad a higher occurrence rate of bacterial translocation than sham - shocked rats (P < 0.01). When administered before the induction of shock, the recombi-nant L. lactis significantly reduced the occurrence rate of shock - induced bacterial translocation (P < 0.01).2. Changes of HO - 1 content in ileum. Hemorrhagic shock significantly increased the content of HO -1 in ileum ( P < 0.01), while the content of HO-1 in ileum was the highest in LL - HO group ( P < 0.01).3. Changes of MDA content in ileum. Hemorrhagic shock caused a significant increase in MDA content in ileum (P < 0. 05, P < 0.01), but treatment of rats with recombinant L. lactis significantly decreased MDA levels ( P < 0. 01).4. Histopathological analysis of ileum. The rats in sham group showed entirely normal histological appearance, and histopathological findings as odema, inflammatory cells infiltration and mucosal damage were seen in HS and LL groups. The histological damage of ileum caused by hemorrhagic shock was significantly ameliorated by engineering L. lactis treatment.Conclusions1. The rat HO -1 gene was successfully cloned.2. The rat HO - 1 displaying biological activity was expressed in the recombinant L lactis NZ9000.3. The recombinant L lactis expressing rat HO - 1 reduced hemorrhagic shock induced bacterial translocation -and mucosal damage of ileum by gastric perfusion in rats, and the mechanism of this protection was associated with the anti - oxidative activity of HO - 1 expressed by the recombinant L. lactis .