Experimental Studies On The Role Of PEgr-IL18-B7.2 Combined With Radiation In Tumor Treatment And Its Possible Mechanisms

Tumor gene-radiotherapy is newly developed in recent years, which cansolve effectively the existing problems of radiotherapy and genetherapy. In thisstudy, according to the mechanism that ionizing radiation can activate earlygrowth response-1 (Egr-1) gene promoter and induce the expression ofdownstream genes, IL18 gene which is recently considered to be an anti-tumorfactor and costimulatory molecule B7.2 were transfected into tumor cellsthrough the gene delivery system of dual-gene co-expression vector. ExpressedIL18 and B7.2 in melanoma cells B16 will enhance the immunogenicity oftumor cells and the immunity of the host. Therefore, not only can we treat thetumor more efficiently by the synergism of gene therapy, immunotherapy andradiotherapy, but also the gene expression can be controled by giving differentdoses of irradiation or at different time points. The combination of radiation,gene and immunotherapy would provide a promising way for cancer therapy.1. Construction of recombinant plasmid1.1 The cloning and identification of murine B7.2Specific primers for mB7.2 were designed with the following primers:sense –AACTTACGGAAGCACCCACG,antisense –CTCTCACTGCCTTCACTCTGC,The splenocytes were retrieved as the template from mice and RT-PCR wasused to obtain the full-length sequence of mB7.2. The product was identifiedby cleavage with endonucleases and sequencing process, the correct mB7.2was then used for the following procedures.1.2 The construction and identification of recombinant plasmidspCMV-IL18, pCMV-B7.2 and pCMV-IL18-B7.2 were constructed,simultaneously, pEgr-IL18, pEgr-B7.2 and pEgr-IL18-B7.2 were constructed byreplacing the CMV promoter with Egr-1 promoter. All the recombinant plasmidswere identified and the radiation-induced expression of these plasmids wereobserved in vitro.2. The enhanced expression of recombinant plasmid induced by radiation2.1 The changes in protein levels of IL-18 and B7.2 after different doses ofradiationThe recombinant plasmids were packed with liposome and transfected intohost cells. B16 melanoma cells were irradiated with 0, 0.1 ,0.5, 2.0, and 5.0 Gy24 h after the transfection of recombinant plasmid and the supernatants werecollected 8 h after the radiation for the detection of IL-18 by ELISA. It wasdemonstrated that radiation could increase the expression of mIL-18 inplamid-transfected B16 cells. The flow cytometry analysis showed that theexpression of surface molecule B7.2 was elevated in a dose-dependent manner.2.2 The time-course changes in the expression of IL-18 and B7.2 after 2.0 GyX-radiationB16 melanoma cells were irradiated with 2.0 Gy 24 h after the transfectionof recombinant plasmid and the supernatants were collected at different timeintervals (0, 4, 8,16, 24, 48 h after the radiation) for the detection of IL-18 andB7.2. ELISA results showed that the secretion of IL-18 began to increase at 8 hand reached its peak at 48 h. The flow cytometry analysis illustrated that in theplamid-transfected B16 cells the expression of B7.2 was increased significantlyas compared with the sham-irradiation control (p<0.05). The expression of B7.2increased with time until 16 h in single gene group or 8 h in double gene groupafter irradiation, followed by its return toward basal level. But they were stillhigher than the control group 48 h after irradiation (p<0.01). Maximalexpression of B7.2 induced by irradiation was earlier than that of B7.1.3. The growth suppression of tumor by combination of plasmidtransfection with radiationThe B16 melanoma cells were implanted in the right-hind leg of C57BL/6J micesubcutaneously, and gene transfection was given when the tumor size reached100 mm3 and radiotherapy (5 Gy) was given 1, 3, 5 d after the injection ofpalsmids. The results showed that in 5 Gy alone and 5 Gy plus gene therapygroups the growth of tumor was suppressed significantly from day 8 after thetreatment (p<0.05), the tumor growth in the group pEgr-IL18-B7.2 combinedwith 5 Gy was more slowly than in the group of 5 Gy alone (from day 10 to 16),and than in group pEgr-IL18 plus 5 Gy or pEgr-B7.2 plus 5 Gy (from day 12 to16), and the tumor growth in the group pEgr-IL18 with 5Gy or pEgr-B7.2 with5Gy was slower than in the group with 5 Gy alone (from day 14 to 16).Treatment with plasmids containing B7.2 or B7.1 plus irradiation was moreeffective than irradiation only, while there was no difference observed betweentreatment results with plasmids containing B7.2 or B7.1 incombination withradiation.4. The immunological mechanisms of gene-radiotherapyWe chose the best protocols of treatment, i.e., pEgr-IL18-B7.2 alone or thatcombined with 5 Gy radiation, for the exploration of the possible immunologicalmechanisms. 4 groups were designed including control, pEgr-IL18-B7.2 alone,5 Gy alone, and pEgr-IL18-B7.2 combined with 5 Gy. C57BL/6J mice-bearingB16 melanoma were sacrificed and splenocytes and peritoneal macrophageswere obtained 1 d or 3 d after gene-radiotherapy. The NK activity, CTL activity,secretion of IFN-γ by splenocytes and TNF-α secretion by peritonealmacrophages were examined. The results illustrated that NK and CTL activitiesof mice with injection of pEgr-IL18-B7.2 followed by 5 Gy were enhancedobviously as compared with control and 5 Gy X-irradiation alone (p<0.05).Moreover, the NK activity of splenocytes and the secretion of TNF-α byperitoneal macrophages, although decreased a little by 5 Gy radiation, increasedafter the combination of pEgr-IL18-B7.2 with radiation, which suggested thereduction of the side-effects of radiation to some extent by the gene therapy.