A Molecular Biological Study Of The Gene Encodes Cariogenic Agents Of Streptococcus Mutans

In this chapter, To study the structural gene for the streptococcal surface antigen Ⅰ/Ⅱ and glucosyltransferase on the basis of the current status of caries research. This study consists of two parts:Part Ⅰ . Polymerase chain reaction amplification, cloning, partial sequence analysis of streptococcal glucosyltransferase-encoding DNAs and its biological signification.According to the sequence of the streptococcus mutants GS-5 (Serotype C, Shiroza, et al. 1987), We designed and synthetized two couples of primers. Ⅰ : primer 1, 5' — TCTAATGGT-GAAAAGCTTCAAAAT-3' (nucleotides 1036～1059); Primer 2, 5'- TGTGACGATATCTTTATTTACAGTGTC - 3' (nucleotides 1321 ～ 1347). Ⅱ : primer1, 5' - TTCCAAGCTTTCGCCACT - 3'...