Font Size: a A A

Effects Of Bradykinin On The Expression Of PCREB, Interleukin-1β And Interleukin-6 In C6 Glioma Cells

Posted on:2008-03-24Degree:DoctorType:Dissertation
Country:ChinaCandidate:Z H WangFull Text:PDF
GTID:1104360215481338Subject:Physiology
Abstract/Summary:
Effects of Bradykinin on the Expression of pCREB, Interleukin-1βand Interleukin-6 in C6 Glioma CellsObjectiveBlood tumor barrier limits adequate delivery of antitumor agents to tumor tissue. Studies demonstrated bradykinin or its analog, receptor-mediated permeabilizer-7 can selectively open the blood brain barrier in the tumor tissue to favor the delivery of antitumor agents to minor tissue without increasing the permeability of blood brain barrier in the normal tissue. The exploration of the mechanism of bradykinin opening the blood brain barrier may be useful in directing the application of bradykinin in the chemotherapy of malignant brain tumors. Currently scientists agree that the combination of bradykinin and B2 receptor can elicit an increase of intracellular Ca2+ concentration. Elevated cytosolic Ca2+ induces the activation of nitric oxide synthase, and then nitric oxide(NO) is generated. Subsequently, high concentration of of cyclic guanosine 3'5'-monophosphate(cGMP) is released. It has been verified that NO and cGMP can increase the permeability of blood brain barrier.CREB is an important nuclear transcription factor that was originally found to be activated by cAMP-dependent protein kinase. Recent studies demonstrated that phosphorylation of CREB is also mediated by Erk, p38 MAPK, calcium-calmodulin kinase (CaMK), and the Akt protein kinase pathway. CREB is activated by phosphorylation on specific serine residues and has been implicated in the regulation of the expression of many genes and cellular processes important in brain function through binding to CRE within promoter and enhancer sequences of genes. CREB plays an important role in the apoptosis of cancer cells, neuronal development and synapse formation etc. Presently, the study of effects of CREB on the structure and function of blood brain barrier remains unkown. Cruzalegui et al reported that hypoxia could result in a transient increase of intracellular Ca2+ concentration, which activated some transcription factors such as CREB, c-los and NF-κB and then tight junction was deformed and the permeability of blood brain barrier was increased as a result.ZHAO WQ et al reported that bradykinin was capable of induce the phosphorylation of CREB. Studies demonstrated there was the NO/cGMP/PKG/CREB signal pathway in the hippocampus. Phosphorylation of CREB is also mediated by calcium-calmodulin kinase, so we plan to use cultivated rat C6 glioma cells to determine whether bradykinin can promote the phosphorylation of CREB and explore the implicated mechanism.Exposure of human brain microvessel endothelial cell to various cytokines including TNF-α, IL-1βdecreased transendothelial electrical resistance mainly by increasing the permeability of the tight junctions. IL-1βis capable of inducing the expression of some cytokines such as TNF-α, IL-8, which can increase the permeability of blood tumor barrier. IL-1βalso can induce human brain microvessel endothelial cell to secrete intercellar adhesion molecule 1 in vitro. Studies demonstrated IL-1βcould upregulate the expression of bradykinin B2 receptor. Bradykinin has a potent stimulatory effect on the secretion of IL-1βof many types of cells such as A549 cells, but whether bradykinin can stimulate glioma cells to secret IL-1βremains unclear.Sanagi et al have demonstrated the induction of pro-inflammatory genes(IL-1,IL-6 and TNF-α) by pigment epithelium-derived factor is mediated via activation of NF-κB or CREB in microglial cells. CRE sites exist in the promoter regions of several pro-inflammatory genes, such as IL-1, IL-6 and TNF-αwhich indicate they can regulated by CREB, therefore, we suppose bradykinin may upregulate the expression of IL-βto open the blood tumor barrier through the activation of CREB.Even though the upregulation of IL-6 is associated with the increased permeability of blood tumor barrier, recently, many studies have demonstrated the expression of IL-6 was detected in human gliomas, glioma cell lines and normal astrocytes. The abnormal expression of IL-6 was suggested to be closely correlated with the pathogenesis, progression and malignant degree of gliomas. bradykinin, as a kind of inflammatory mediator also has a potent stimulatory effect on the secretion of IL-6 of many types of cells such as pulmonary cells. We have a suspicion that bradykinin would induce an increase of the secretion of IL-6 in glioma cells when it opened blood tumor barrier, which might enhance the potential risk of clinical therapy of gliomas with bradykinin.In this study, Immunocytochemistry and western-blot method were used to study the activation of transcription factor CREB in the rat C6 glioma cells induced by bradykinin; semi-quantitive RT-PCR and radioimmunoassay were used to detect the expression of IL-1βand IL-6 in C6 glioma cells and culture media treated with bradykinin respectively. Furthermore, we determine whether IL-1βexpression stimulated by bradykinin in C6 glioma cells is mediated by the phosphorylation of CREB by RNAi.Materials and MethodsMaterials1. CellsRat C6 glioma cell strain was provided by cytobiological laboratory of China Medical University.2. AgentsDMEM, 0.25%trypsin(Gibco); fetus cattle serum(H&Y Company, Tianjin); bradykinin(Sigma, U. S. A); Lipofectamine2000(Invitrogen); anti-phospho-CREB (Ser133) and anti-CREB antibody (Cell Signaling Technology); SABC kit, DAB kit(Boster Biological Technology Company, Wuhan); peroxidase-conjugated anti-rabbit IgG(Zhongshan Company, Beijing); RNAout, IL-1β, IL-6 primers, RT-PCR reagents(Takara); chemically synthesized CREB-specific siRNA and random sequence siRNA(Jima Biological Technology Company, Shanghai); IL-1β, IL-6 RIA kit(Dongya Company, Beijing).3. Experimental instrumentsCO2 incubator; invert microscope; low temperature centrifuger; electrophoresis apparatus; transmark apparatus; PCR apparatus. Methods1. Cell cultureThe C6 glioma cell strain was cultured in Dulbecco's modified Eagle's medium (DMEM; high glucose) containing 10% fetal bovine serum in a humidified atmosphere of 5% CO2. When cultures became confluent, the cells were trypsinized with 0.25% trypsin. All experiments were carded out when cultures had become confluent.2. Immunocytochemistry of pCREB proteinWhen cultured C6 glioma cells became confluent, they were treated with 1μmol/L bradykinin at various time points(0, 5, 10, 15, 20, 30min), then immunocytochemistry was used to determine the phospborylation of CREB. The data was quantitatively analyzed by Motic images advanced 3.0 software.3. Western-blot of pCREB proteinCultured C6 glioma cells were treated with 1μmol/L bradykinin at various time points (0, 5, 10, 15, 20, 30min), then the cells were collected ,and western-blot method was used to determine the phosphorylation of CREB. IDV of pCREB protein bands scaned by ChemiImager5500V 2.0 software was quantitatively analyzed by Fluor Chen 2.0 software.4. RT-PCR analysis of IL-6mRNA and IL- 1βmRNA Cultured C6 glioma cells were treated with 1μmol/L bradykinin for 0~60min, then total RNA was extracted from cultured glioma cells, according to the manufacturer's instructions for the RNAout. In this study, 1μg of total RNA was converted to first-strand cDNA, the resulting cDNA was subjected to PCR analysis in accordance with the manufacturer's instructions. The PCR products were stained with ethidium bromide after agarose gel electrophoresis and photographed using GAPDH served as the unchanging control mRNA. IDV of these mRNA levels were normalized with respect to GAPDH gene expression with software(FluorChen V2.0). The actual sequences of specific primers are summarized as following: (1)IL-1β: Sense Primer CGATCGCGCAGGGGCTGGGCGG, Antisense Primer AGGAACTGACGGT ACTGATGGA, 445bp; (2) IL-6: Sense Primer CT.ACGAAGAACTGGCAATATG, Antisense Primer AAACCATCTGGCTAQGTAAGA, 207bp; (3)GAPDH: Sense Primer AAGGGCTCATGACCACAGTCC, Antisense Primer ACCCTGTTGCTGTAQ CCATCC 461bp.5. Radioimmunoassay analysis of IL-1βand IL-6Cultured C6 glioma ceils were treated with 1μmol/L bradykinin for 0~60min, then the culture media were collected, radioimmunoassay analysis was performed according to the manufacturer's instructions.6. siRNA transfectionCREB-specific siRNA: Sense: 5'-UGACUUAUCUUCUGAUGCATT-3'; Antisense: 5'-UGCAUCAGAAGAUAAGUCATT-3'; random sequence siRNA: Sense: 5'-UAUAGCUUACUAGCUCUUGTT-3'; Antisense: 5'-CAAGAGCUAGUAAG CUAUATT-3'. Both the non-transfected cells and non-specific siRNAs transfected cells were taken as controls. C6 glioma cells were transfected with chemically synthesized CREB-specific siRNA and random sequence siRNA formulated with Lipofectamine 2000 respectively. Seventy-two hours later the cells were collected. The expression of CREB was determined by western-blot.7. RT-PCR analysis of IL-1βmRNA in C6 glioma cells transfected with CREB-specific siRNA prior to treatment with bradykininRelative IL-1βmRNA expression levels were measured in C6 glioma cells transfected with CREBsiRNA(80nM) prior to stimulation with bradykinin (1μmol/L) for 0, 5, 10, 15, 30 and 60min. The non-transfected cells were taken as controls. Total RNA was extracted from cultured glioma cells, according to the manufacturer's instructions for the RNAout. In this study, 1ug of total RNA was converted to first-strand cDNA, the resulting cDNA was subjected to PCR analysis in accordance with the manufacturer's instructions. The PCR products were stained with ethidium bromide after agarose gel electrophoresis and photographed using GAPDH served as the unchanging control mRNA. IDV of these mRNA levels were normalized with respect to GAPDH gene expression with software( FluorChen V2.0).8. Radioimmunoassay analysis of IL-1βin the supernate of culture media transfected with CREB-specific siRNA prior to treatment with bradykininBioactivity of IL-1βwas detected in the supernate of C6 glioma cell culture media transfected with CREB siRNA(80nM) prior to stimulation with bradykinin (1μmol/L) for 0, 5, 10, 15, 30 and 60min by radioimmunoassay. The non-transfected cells were taken as controls. Radioimmunoassay analysis was performed according to the manufacturer's instructions.9. Statistical analysisThe data are presented as the mean±SD. Student's t tests were calculated for two group comparisons with SPSS 13.0 statistical software. Statistical significance was assumed if P value was less than 0.05.Results1. Bradykinin at 1μmol/L induced phosphorylation of CREB in the glioma cells at the indicated time points(0~30min)(P<0.01), the phosphorylation of CREB reached a peak at 15min and weakened markedly at 30min(P<0.01).2. Semi-quantitive RT-PCR revealed that the expression of IL-1βmRNA was significantly elevated with bradykinin treated for 15min (P<0.05), then was attenuated gradually. Radioimmunoassay also revealed that the bioactivity of IL-1βin the cell culture media was strongest with bradykinin treated for 15min.3. Semi-quantitive RT-PCR revealed that the expression of IL-6mRNA was detected at the different time points (0, 5, 10, 15, 30, 60min) in C6 glioma cells treated with bradykinin at a dose of 1μmol/L, and there was no statistical significance between the treatment groups and control group(P>0.05). Radioimmunoassay revealed that the expression of IL-6 in the cell culture media was not detected.4. Sequence specific siRNA targeting CREB downregulated CREB expression significantly compared with the blank control group, and no obvious suppression of CREB expression was observed in C6 glioma cells transfected with random sequence siRNA. RT-PCR and radioimmunoassay revealed downregulated expression of IL- 1βwas not observed in C6 glioma cells and the supernate of culture media that were transfected with CREB-specific siRNA prior to stimulation with bradykinin. Conclusion1. The results demonstrated that CREB could be activated in glioma cells induced by bradykinin. Posphorylation of CREB may play a role in the selectively opening the blood tumor barrier induced by bradykinin.2. The secretion of IL-1βcan be increased in C6 glioma cells induced by bradykinin, which may play an important role in the process of bradykinin augmenting the permeability of the blood tumor barrier.3. The expression of IL-6 can not be strengthened in C6 glioma cells induced by bradykinin within an hour, which may provide a favorable experiment basis for the security of clinical application of bradykinin.4. Chemically synthetic siRNA targeting CREB was capable of suppressing CREB expression, the successful application of CREB-specific siRNA for inhibition of CREB provide a novel way for the study of functions of CREB in the nervous system; while CREB was not implicated in the secretion of IL-1βstimulated by bradykinin.
Keywords/Search Tags:Glioma, bradykinin, CREB, IL-1β, IL-6
Related items