The Research Of E6AP Gene In The Pathogenesis Of Cervical Carcinoma

Cervical cancer is one of the malignant tumors severely affecting the health of women. It is the most common gynecological malignant tumor. Its occurrence is caused by many factors in a process of numerous steps, and the cause is still unclear. Domestic and foreign scholars have always paid great attention on the research on the cause of cervical cancer. At the end of the seventies of the 20^th Century, Zur first raised the hypothesis that the cause of cervical cancer is the human papillomavirus (HPV). Currently, it is believed that HPV is the most important factor in causing cervical cancer. HPV, especially high-risk HPV, is closely associated with the occurrence and development of cervical cancer. HPV may be detected in more than 90% of cervical cancer tissues. Cervical cancer cells express E6 and E7 cancer protein.E6 associated protein (E6AP) is a type of ubiquitin protein ligase of the cell coding, belonging to the family of ubiquitin ligase. E6AP may combine with HVP E6 cancer protein to form E6-E6AP compound. E6 gene is one of the key genes of HPV, especially high-risk HPV, and E6AP only combines with high-risk HPVE6 protein. The research shows that E6AP is the media for many of the functions of E6．The combining of the E6 protein with the core area of the p53 protein relies on E6AP, forming E6/E6AP compound. E6AP only combines with high-risk HPVE6 protein, and degrades p53 protein by ubiquitin pathway-dependent methods. The treatment on ubiquitin ligase gene will become the new focus of the research and treatment of cervical cancer. Recently, it is discovered that the ubiquitin proteasome pathway is linked to the cancer associated lack of adjustment, taking part in many metabolic processes of eukaryotic cells such as cancer transformation, tumor development, immune escape and drug resistance. Treatment on ubiquitin ligase will become the new focus of the research and treatment of cervical cancer. Therefore, this pathway may be the key target in the cancer abnormal adjustment mechanism.RNA interference (RNAi) is a great discovery in the recent years by mankind. The slicing guide sequence of RNA interference and combining to the exterior of the sliced mRNA molecule is an important measure to inhibit human cell with RNA. RNAi is the gene silencing process after transcription of double-stranded RNA molecule induced sequence specific primer, the process of turning off the related gene expression on the mRNA level by the double-stranded RNA molecule. It is a novel technique of gene blocking. Currently, the acknowledged RNAi action mechanism is: the double-stranded RNA in organic cells is recognized and spiced by Dicer enzyme, forming siRNA of 21 to 23 nt. The compound formed by the siRNA and a series of nuclease is called RNA induced silencing complex (RISC). The compound contains helicase and endonuclease. Helicase dissolves the siRNA double helix and convert it into an activated form. The siRNA complementary to the target mRNA is called the antisense siRNA. The antisense siRNA induces the activated compound to recognize and combine with the mRNA which is complementary to its specific primer, and eventually come into effect by inducing the endonuclease to cut the mRNA into pieces.Inspect the E6AP gene expression in cervical cancer tissue, tissue of chronic cervical inflammation, and CIN tissue, and analyze the relationship and the clinical significance between E6AP gene and the clinical pathological characteristics of cervical cancer. Apply RNA interference techniques to chemically form siRNA and create short hairpin RNA (shRNA) to express the effect on E6AP gene mRNA and protein expression after having the plasmid acting on the E6AP gene, and the effect of inducing the cervical cancer cell to multiple and die out. At the same time, compare the change of hTERT before and after the interference. Investigate the relationship between E6AP and hTERT. Investigate the effect and the associated molecular mechanisms of E6AP gene in the occurrence and development of cervical cancer, which will provide scientific experimental bases for the genetic diagnosis and medicinal treatment of cervical cancer. 1,RT-PCRChoose 35 immersed cervical cancer samples for biopsy which are surgically removed in gynecological surgeries at the Second Affiliated Hospital of China Medical University from May 2004 to May 2006．Choose ten samples for each of chronic cervical inflammation tissue and CIN tissue. According to the procedures listed on the Trizol reagent kit, conduct total RNA extraction of tissue and reverse transcript into cDNA.The order of the prime of E6AP is: 5'-AATCCTGCAGACTTGA AGAA-3' and 5'-TCCACATTCCCTTCATACTC-3'. The reaction conditions of the PCRreaction system are: after transformation at 93℃for 1 minute, repeat the cycle in the order of at 93℃for 30 seconds, at 56℃for 30 seconds, and at 72℃for 45 seconds for 30 times, the last duration at 72℃is extended to 10 minutes.2,Forming siRNAThe template design adopts the online tool provided by the company of Ambion. The length of every pair of template is 29 bases, including the eight bases which are complementary to the T7 promoter sub-sequence and 21 bases complementary to the target gene. Form the RNA sense strand and antisense strand of 21 bases with the Ambion SilencerTM Sirna Construction Kit, and anneal to form the double-stranded RNA. E6APsiRNA is as follows: Antisense: 5'-UAUCUCAGAGCAGGAGUUGUU-3' Sense: 5'-CAACACCUGCU CUGAGAUAUU-3．Non-sense control: Antisense: 5'-AGGUGACUAGCACUGUUAGUU-3',Sense:5'-GUAACAGUGCUAGUCACCU UU-3'.3,shRNA vector constructionAccording to the E6AP sequence reported by GenBank, the software provided by the company Ambion is used to design the RNAi sequence of the E6AP gene, forming the DNA sequence, and the middle loop selects: the four bases of TTCG, the two sides are cut site sequence of the enzyme connecting to the carrier. RNAi-E6AP template A:5'-TCGAC CAACTCCTGCTCTGAGATA TTCG TATCTCAG AGCAG GAGTTG TTTTTTTA-3'; B:5'-AGCTTAAAAAAACAACTCCTGCTCTGAGAACGAATATCT CAGAGCAGGAGTTGG-3'.RNAi-Non-sense template : A:5'-TCGACCTAACAG TGCTAGTCACCTTTCGAGGTGACTAGCACTGTTAGTTTTTTTA-3' ; B:5'-AGC TTAAAAAAACTAACAGTGCTAGTCACCTCGAAAGGTGACTAGCACTGTTAG-3'. Form the DNA sequence, and anneal to the double-stranded DNA. SalⅠ/HindⅢenzyme-cut plasmid, recover carriers after 1% gelose electrophoresis, then connect with the RNAi-E6AP template. The obtained restructured plasmid convert DH5αcompetence coliform, extract plasmid after selecting the positive clones, transfect the cells after sequence testing and verification.4,Cell culture and plasmid transfection:Hela cell is cultured in 10% fetal bovine serum and 1% double resistant RPMI1640 solution. Use siRNA transfection reagent TransMessenger to transfect the chemically formed siRNA. Use liposome transfection reagent Lipofectamin 2000 to transfect plasmid. Operate according to the operating procedures of the liposome.5,RT-PCRExtract total RNA from each set of cells by adding Trizol solution, reverse transcript into cDNA. The conditions of the reverse transcription are: after transformation at 93℃for 1 minute, repeat the cycle in the order of at 93℃for 30 seconds, at 56℃for 30 seconds, and at 72℃for 45 seconds for 30 times, the last duration at 72℃is extended to 10 minutes. The order of the prime of E6AP is: 5'-AATC CTGCAGACTTGAAGAA-3' and 5'-TCCACATTCCCTTCATACTC-3'. Withβ-actin protein gene as the internal comparison.Conduct gelose gelatin electrophoresis, ultraviolet ray photography and analyze the PCR product.6,Western blotApply Western blotting. The cell is dissolved in 4% sodium dodecyl sulfate (SDS) solution, blended, centrifuged, and the total protein of the cell is extracted. Coomassie brilliant blue method is applied to measure the quantity of protein. Take 300μg of total protein from each set of samples, and convert to PVDF film after 10% SDS2 polyacrylamine gelatin (PAGE) electrophoresis. Reside overnight with specific monoclonal resistance I at 4℃. After incubating at room temperature for 2 hours with resistanceⅡ, ECL display color.7,MTT assay Each set of cell undergoes pancreatic enzyme digestion, dilute to the concentration of 1～2×105/ml, add to the 96-hole plate, set three layers of compound hole, culture for 12 hours, add MTT, continue culture for four hours, extract culture solution, add dimethyl sulfoxide (DMSO), shake for five minutes, and continue culture for 30 minutes. Measure the light absorbency atλ= 570 nm.8,Analyze apoptosis with flow cytometerOperate according to the procedures listed on the reagent kit of Anexin V flow centometer. Collect cell, cleanse in PBS, mark the Annexin V antibody and PI, and then conduct duel color fluorescence cell cytometry counting with FACS flow cytometer, and observe the apoptosis rate.9,RT-PCRApply RT-PCR method. The method is the same as the previous. The prime sequence: 5'-GTGGATGATTTCTTGTTGT-3' ;5'-GC AGGAGGATCT TG TAGA TG-3', withβ-actin protein gene as the internal comparison. hTERT/β-actin light density ratio acts as the expression level of hTERTmRNA.10,TRAP-PCR-ELISATo measure cell telomerase activity, we collect each set of cell separately, and measure according to the procedures on the TRAP reagent kit. Simultaneously read A450 and A690 absorption value on the enzyme labeling device for each sample. Calculate result according to△A=A450-A690,△A represents the activity of the cell telomerase. Positive match is provided by the reagent kit, negative match is the heat processed cell extraction.Results1,Checking the expression of E6AP in the tissue by RT-PCR technique, it is discovered that E6AP gene is expressed in chronic cervical inflammation, CIN tissue, and cancer tissue. The expression level of cervical cancer is higher than those of chronic cervical and CIN sets. The difference has statistical significance. E6AP gene expression increases with the progress of the clinical phases of the disease. The expressions of phaseⅠandⅡare significantly different from the expression in phaseⅢ. And it is not correlated with the type, size, tissue categorization, or whether there is migration to the lymph nodes.2,E6AP siRNA are transfected into Hela cell system and measure interference effect. The result shows that siRNA effectively transfected Hela cell and inhibited the expression of the gene. Cell growth activity decreases and apoptosis rate increases, the expression of hTERT gene drops significantly,telomerase activity also drops significantly. Afterward, the interference effect disappears,they recover to the level before interference is applied.3,Successfully form the target shRNA expression plasmid of E6AP gene. Verify that the siRNA gene sequence is correct and meets the requirement by plasmid sequencing. Check the interference effect, the result shows that pNeo-RNAi-E6AP effectively transfect Hela cell and inhibit the expression of the functional genes. Cell growth activity drops and apoptosis rate increases ,the expression of the hTERT gene and the telomerase activity drops significantly. This inhibition effect is notably lengthened.Conclusion1,A certain molecular biological relationship exists between E6AP and cervical inflammation, CIN, and cervical cancer.2,The expression of E6AP gene significantly increasing with the progress of the clinical phases of the disease means that the E6AP gene takes part in the occurrence and development of cervical cancer.3,E6APsiRNA may effectively lower the expression of the E6AP, drops cell growth activity and increases apoptosis rate significantly. E6APshRNA may effectively, and in a prolonged period, lower the expression of Hela cell on gene and protein level,drops cell growth activity and increases apoptosis rate significantly.4,The expression of hTERT and telomerase activation is dependent on E6AP.