| ObjectiveDespite nearly two decades of research directed at inducing adaptive immunityor vaccine, there was no significant achievement has been made. On the basis ofrecent observations, it is suggested that the study on innate immune responses is veryimportant in HIV infection. Monocytes/macrophages are the main cells in innateimmune responses. They can phagocytose and eliminate foreign antigen such as HIVand posses the antigen-presenting function. Since the surface of monocytes/macrophage has CD4 receptor, HIV can infect monocyte/macrophage. Activated byHIV, monocyte/macrophage secreted many bioactive media, as TNF-α,IL-1,IL-6, inorder to adjust the immune response. At the same time,TLR4 existed on themembrane of the monocyte is a sensitive receptor that has relationship withtransmembrane signal transmission and become a hot point in current study. Thefurthest study found that the signal pathway by TLR4 would accelerate the transferprocess of HIV when HIV infected. At present the role of the system ofmonocyte/macrophage in HIV infection has not been clear. We study the expressionand activation of peripheral blood monocyte and the expreesion of TLR4 in ChineseHIV/AIDS patients in various process, and analyze combined with the TNF-αin plasma and HIV virol load, explore the effect of monocyte/macrophage and TLR4expression in the disease progression of HIV/AIDS after HIV infection and likelihoodillness machanism.Material and Methods1. Study subjectsAll patients were from Liaoning, Jilin and Henan province in China. HIVserology was determined by ELISA (Vironostika, Organon Tednika, The Netherlands)and confirmed by Westem blot (Genelab Diagnostic, Singapore) in the HIVConfirmation Laboratory at University Hospital. Ethical approval and informedconsent were obtained before blood donation. The following conditions, which cannonspecifically affect blood cell counts, were used as exclusion criteria: previouscytotoxic chemotherapy, splenectomy, hypersplensim, and blood transfusion withinthe past 4 weeks. HIV-infected subjects were classified into 3 clinial stages. The firststage was long term non-progressors (LTNPs) and included subjects with persistentCD4+ T-cell counts more than 500 cell/μl, no antiretroviral therapy, and no clinicalsign of disease for at least 10 years.The second stage was chronical HIV-infectedsubjects and included patients who had CD4+ T-cell counts less than 500 cell/μl, andno AIDS-defining condition without antiretroviral therapy. The third stage was AIDSand consisted of patients with an AIDS-defining condition according to the WorldHealth Organization classification, including CD4+ T-cells less than 200 cells/μl,present or previous opportunistic infections or HIV-related neoplasms.Healthycontrols are the people from the First Affiliated Hospital Physical Examination Centerwere used as healthy control.They were randomly enrolled and then matched for ageand gender with the subjects' population.Thirty-six seronegative subjects that neverexposed to HIV-1 were selected as normal controls.2. CD4+ T cell absolute count Pipette 20μl of TriTEST CD4-FITC/CD8-PE/CD3-PerCP regent and add 50μlanti-coagulated whole blood into the bottom of the TruCOUNT Tube using reversepipetting and incubate for 15 minutes in dark at room temperature, add 450μl1×FACS lysing solution to the tube, incubate for 15 min in the dark at roomtemperature and analyze the samples on the flow cytometer, using FACS MULTISETsoftware to acquire T lymphocyte count and corresponding ratios.3. Determination of viral loadPlasma HIV RNA levels were determined using a commercial assay (ROCHECOBAS AMPLICOR SYSTEM) according to the manufacture's instructions,undetectable levels of RNA in plasma were considered equivalent to 400 copies/ml.4. Immunofluorescence Stain and analysis by flow cytometryFor each HIV-1 infected patient, we used the following Abcombinations:CD14-FITC/CD69-PerCP/TLR4-PE. 100μl whole blood was added andthe 10μl of each Abs were added as the combinations show above. Aider a 30-minincubation at room temperature, the erythrocytes were lysed using 3ml RBC lysingsolution. The cells were washed twice with PBS and resuspended in 2ml PBS solutionconsist of 1%polyformaldehyde. There color flow-cytometric analysis was performedand FACS CELLQUEST soft-ware was used to make analysis.For subset analysis, monocyte were gated by forward scatter and side scatter,then CD14+/FSC were gated and the CD69 expression and TLR4 expression onCD 14+cells were calculated.5. Separate PBMC by density centrifugationPBMC of subjects were isolated by standard Ficoll-hypaque densitycentrifugation.6. Preparation RNA of PBMCTotal RNA was extracted from PBMC using an acid-guanidinium-phenol-chloro-form method (QIAGEN) according to the manufacturer's protocol. RNA concentrations were assessed by spectrophotometry at the 260:280 ratio.7. Design and synthesize the primer and probeDesign the primer and probe by the software Primer express2.0, the forwardprimer of TLR4 is TGGAAGTTGAACGAATGGAATGTG, the backward primer ofTLR4 is ACCAGAACTGCTACAACAGATACT, the probe isFAM-AGCACACTGAGGACCGACACACCAA-TAMRA. Inside refer is GAPDH, and its forward primer isGAAGGTGAAGGTCGGAGTC, its backward primer is GAAGATGGTGATGGGATTTC, the probe is FAM-CAAGCTTCCCGTTCTCAGCC-TAMRA. By BLASTwith the primer and probe, the rate of matching is 100%.8. The construction of the standard plasmidReverse transcriptase Polymerase Chain Reaction was done by the TaKaRa kitaccording to the manufacturer's protocol. The RT reactive system is total RNA 1μg,random primer 50pmol, 5×ExScript buffer 2μl, dNTP Mixture 10mM, RNaseinhibitor 10U, ExScriptTM RTase 10U, filled to 10μl by RNase Free dH2O.Thereaction condition is 42℃for 30 min, 95℃for 5min, 4℃finished. Keeping cDNAfreezed by-20℃.9. Real-time RT-PCRReal-time PCR was performed on LightCycler Real-time PCR system (Roche,Mannheim, Germany) with an ExTaq RT-PCR. The amplification conditions were asfollows: for TLR4 and GAPDH 94℃for 2 min and 40 cycles of 95℃for 15 s and62℃for 1 min. Recombinant pGEM T-vectors (Promega) containing TLR4 orGAPDH cDNA were constructed by PCR cloning and were used to establish thestandard curves.The initial copy number of the target mRNA was calculated from thestandard curve. The amount of TLR4 transcripts of individual samples wasnormalized to GAPDH.10. Detection of TNF-αlevels in plasma Plasma TNF-αlevels were determined by an Ultra-sensitive commercialenzyme-linked immunosordent assay (ELISA)(R&D company) according to themanufacturer instructions.11. Statistical analysisResults were given as mean value±standard deviation of the mean.Comparisons of means of different groups were done by using t-test, and pearsmancorrelation rate and diffused-dot chart were used as a measure of correlation analysis.Probability values less than 0.05 were considered significant. SPSS 11.5 software wasused to make the Statistical analysis.Results1. The comparison of activation and phagocytosis function ofperipheral blood monocyte/macrophage of HIV/AIDS patientsAS shown in the Results, the ratios of CD14+ in the peripheral bloodmononuclear and CD14+ antigen level of HIV/AIDS patients have no statisticssignificance compared with the control group. Gates were set up by CD14+ cells inboth groups, the expression of earlier period active molecule CD69 on CD14+ inHIV/AIDS group is significantly higher than that in healthy control group. Moreover,the expression in AIDS group is higher than HIV and LTNP group, and the differencesare statistically significant (p<0.05), but no markedly difference exists between LTNPgroup and healthy control.2. The relationship between the expression of CD69 on peripheralblood monocyte/macrophage of HIV/AIDS patients and diseaseprogressionThe correlation between the expression of CD69 on peripheral blood monocyte/macrophage and the amount of CD4+ lymphocyte: the expression of CD69on peripheral blood monocyte/macrophage in HIV/AIDS patients increases alongwith the decrease of absolute count of CD4+T lymphocyte. Through the correlationanalysis, the expression of CD69 on peripheral blood monocyte/macrophage showsobvious negative correlated with CD4+T lymphocyte absolute counts, r=-0.872,P<0.01.3.The expression of TLR4mRNA of PBMC in HIV/AIDS patientsand healthy controlsThe expression of TLR4mRNA of PBMC in HIV group and AIDS group weremore than that in healthy controls (p<0.05);there was no significant difference inLTNP and control groups.4.The correlation between the expression of TLR4mRNA of PBMCin HIV/AIDS patients and HIV-1 viral loadThrough the correlation analysis, the expression of TLR4mRNA of PBMC inHIV/AIDS patients and HIV-1 viral load are significantly positive correlated, r=0697,P<0.01.5. The expression of TLR4 on peripheral blood monocyte ofHIV/AIDS patients and the concentration of TNF-αin plasmaThe rate of positive expression and MFI of TLR4 on peripheral blood monocyteof HIV/AIDS patients are separately 52.19±4.37%and 74.25±7.06, which aresignificantly higher than health control, p<0.0001; The concentration of TNF-αinplasma of HIV/AIDS patients is 35.79±5.08 pg/ml, which is statistics different fromhealth control, p<0.0001.6. The correlation between rate of positive expression of TLR4 onperipheral blood monocyte of HIV/AIDS patients and the concentration of TNF-αin plasmaThe concentration of TNF-αin plasma of HW/AIDS patients increases alongwith the rise of rate of positive expression of TLR4 on peripheral blood monocyte.Through the correlation analysis, it is clear that the rate of positive expression ofTLR4 on peripheral blood monocyte of HW/AIDS patients and the concentration ofTNF-αin plasma are positive correlated, r=0.645, p<0.01.7. The correlation between rate of positive expression of TLR4 onperipheral blood monocyte of HIV/AIDS patients and HIV-1 viral loadThrough the correlation analysis, the rate of positive expression of TLR4 onperipheral blood monocyte of HIV/AIDS patients and HIV-1 viral load aresignificantly positive correlated, r=0.708, P<0.01.Conclusion1. The function of activation and phagocytosis of monocyte/macrophage ofChinese HIV/AIDS patients rises significantly compared with the healthy controlgroup, and correlate with the disease progression.2. It was approved that the expression of TLR4mRNA increased in ChineseHW/AIDS patients by the molecule level, and the amotmt of TLR4mRNA expressionwas correlated with the disease progression of AIDS.3.The expression of TLR4 on peripheral blood monocyte of HIV/AIDS patientsgoes upward, and TLR4 could promote HIV duplicate by accelerating the secretion ofTNF-α. |