AGEs-induced Endoplasmic Reticulum Stress Caused Premature Aging Of Renal Tubular Epithelial Cells To Promote Renal Interstitial Fibrosis Of Diabetic Nephropathy-the Role Of ATF4-p16/p21

The nature of cellular senescence is cell cycle arrest caused cell proliferation and loss of regenerative capacity, leading to structure and adaptive changes of organ function. Aging often leads to cell replicative senescence, dependent on the regulation of telomere shortening and telomerase, is a program of biological processes (Programmed biological process), the aging rate and extent present autonomy and orderly, so that adaptive changes of aging organs, rather than showing the disease phenotype. However, more and more evidence that a variety of pathological stress factors can directly damage DNA, activation of oncogenes (Oncogene activation) or telomere shortening and thus activate the cell cycle negative regulator p16/Rb and / or ARF/p53 , so that irreversible cell growth arrest in G0/G1 phase, known as the stress-induced premature or accelerated cellular aging. The characteristic features of senescent cells as cell hypertrophy, cytoplasmic SA-β- gal activity was enhanced, telomere shortening and cell cycle negative regulator of p16 and p21-positive and so on. Now that, regardless of the natural process of cell aging or disease-related premature aging of cells, eventually leading to the same tissue and organ fibrosis as an important pathophysiological basis; the other hand, barriers of cellular senescence mechanisms have resulted in tumor and metastasis. Therefore, the relationship between cells premature aging and disease-induced organ fibrosis highly concerned about in recent years.Diabetic Nephropathy (DN) is the most serious complications of diabetes, easily progressed to chronic kidney failure. it has been confirmed that renal interstitial fibrosis(Tubulointerstitial fibrosis, TIF) play a leading role in the process of diabetic nephropathy to chronic renal failure,Performance of renal tubular epithelial cell loss, chronic inflammation and extracellular matrix accumulation, but the mechanism is not yet clear. Recent studies have found that premature aging of myocardial cells, endothelial cells, nerve cells and other mesenchymal cells are closely related to the development of cardiovascular diseases. From the non-elderly-related chronic kidney disease (CKD) studies have shown that renal cell premature aging is usually associated with injury of chronic renal histological changes, such as glomerulosclerosis, tubular atrophy and inflammation, suggesting that premature aging of cells is a pathological form of kidney damage, rather than simply increasing age due to physiological changes. Recent study found that high glucose can cause premature aging of renal parenchymal cells, the latter has related to the organizational structure of the kidney and renal dysfunction, suggesting that cells premature aging might not only be the result or epiphenomenon of DN , but also may the active participants to promote DN to chronic renal failure . However, the reason and mechanism of premature aging diabetic of renal tubular epithelial cells in diabetic nephropathy is not entirely clear ? Why cells premature aging would result in renal interstitial fibrosis?End-stage glycation products (Advanced Glycation End Products, AGEs) is one of the main cause of diabetic nephropathy. Recent study show that, AGEs can cause podocytes and mesangial cells cycle arrest and glomerular sclerosis.We are interested in whether AGEs can cause premature aging in renal tubular epithelial cells thus play an important role in progress of diabetic nephropathy. Study confirmed that, AGEs, amyloidβand other harmful substances can affect Endoplasmic Reticulum homeostasis lead to accumulation of unfolded proteins or abnormal protein modifications caused cell excessive endoplasmic reticulum stress (Endoplasmic Reticulum Stress, ERS). Endoplasmic reticulum stress is the key mechanisms of regulation of cell survival, proliferation and differentiation, more and more evidence show that excessive ERS is not only the important mechanism of progression in diabetes, cardiovascular disease, chronic kidney disease and old age disease, but also to influence and even drive the aging process itself. over-ERS can accelerate aging-related changes in renal structure and function in mice. ATF4 is a basic leucine zipper transcription factor (Basic leucine-zipper (bZip) transcription factor), binding to the downstream target gene promoters to regulate a number of biological effects, including cell proliferation, differentiation, apoptosis, autophagy and inflammatory response, is considered the master regulatory(Master regulator)factor in evolutionarily conserved mammalian stress response pathway. play a key role in the development of diabetes, cardiovascular disease and tumor. Recent studies have shown, ATF4 gene silencing can significantly inhibit human melanoma cells (MC) aging, over-expression of ATF4 inhibited mouse mammary epithelial cells and nerve cells, cell cycle proteins leading to cell growth arrest, suggesting that ATF4 may regulate the cell aging process .Accordingly, we propose "AGEs-induced excessive endoplasmic reticulum stress caused premature aging of renal tubular epithelial cells to promote renal interstitial fibrosis of diabetes-- the role of ATF4-p16/p21" hypothesis. (?)Methods1. Screening of clinical specimens Select from February 2009 to December 2010 in Chong Qing Da Ping Hospital Nephrology treated elderly patients (namely 60 years old or above) with pathological diagnosed cases of type 2 diabetic nephropathy in 20 cases,which were further classified into two groups based on urine protein excretion and renal function, The first group of subjects had early clinical diabetic nephropathy (defined by proteinuria 500–2,000 mg/day and serum creatinine≤120umol/l, 8 cases), The second group of subjects had an advanced clinical nephropathy (proteinuria >2,000 mg/day and/or serum creatinine >120umol/l,12 cases). Normal portions of kidney tissue far from nephrectomies for renal carcinoma (n =8, above 60 yr) were examined as a control group(proteinuria <500 mg/day and serum creatinine <120umol/l),all cases were excluded from smoking obesity high and blood pressure. And before the biopsy procedure, were not taking any medicine. Kidney Fibrosis 2. Primary Renal tubular epithelial cells culture and identification Under sterile conditions, Isolated and cultured2-3 week-old C57/BL6 male mice renal tubular epithelial cells, immunofluorescence detect renal tubular epithelial cell-specific surface markers CK18 xpression. We use the 6th generations of the tubular epithelial cells as the natural aging group.3. Cell group3.1 AGE-BSA on renal tubular epithelial cells in dose and time group Dose group: Respectively to 0,0.15,0.75,1.5,7.5 uM of AGE-BSA and the same concentration of BSA to stimulate the primary mouse renal tubular epithelial cells after 48 hours; time groups: 7.5uM concentrations of BSA and 7.5uM concentration of AGE-BSA, respectively to renal tubular epithelial cells 0,12,24,36,48 hours.3.2 ERS inducer on tubular epithelial cell aging time group Divided into normal control group,DMSO group,TM group,TG group,in which the concentration of TM group and TG group respectively is 0.5ug/ml 0.1uM, respectively cultured 48h and 72h.3.3 Inhibitor of endoplasmic reticulum stress on renal tubular epithelial cells group and Divided into:Normal control group;AGE-BSA group;AGE-BSA group+ 4-PBA group, the concentration of AGE-BSA and 4-PBA are respectively 7.5uM and 5mM,cultured 48h3.4 ATF4 siRNA-transfected renal tubular epithelial cells group Respectively utilize liposome Lipofectamine ? 2000 plus control siRNA (0.05μM), ATF4 siRNA (0.05μM) transfected to renal tubular epithelial cells after 24 h.cell group:control,control+ConsiRNA group,control+ATF4siRNA group,BSA group,BSA group+ ConsiRNA group,BSA group+ ATF4siRNA group,AGE group,AGE group+ ConsiRNA group,AGE group+ ATF4siRNA group, the concentration of BSA and AGE are 7.5uM,cultured 48h.3.5 ATF4–GFP transfected renal tubular epithelial cells group Divided into: Control,GFP-Vector group,ATF4-GFPgroup, the concentration of adenovirus titer are 5×108PFUml,cultured 48h.4. Detection targets and methods4.1 ELISA detect diabetic nephropathy patients serum and urine levels of AGEs Using ELISA kit detect diabetic nephropathy patients serum and urine levels of AGEs. 4.2 Immunohistochemical detect renal tubular epithelial cellsRAGE, GRP78, ATF4, p16, p21 and interstitial ColⅢ, FN expression Paraffin-embedded tissue sections 2 ~ 4um , dewaxing, hydration; high-pressure repair antigen; 3% H2O2 incubated 15min; PBS wash; goat serum blocking 15min; anti-RAGE (1:350), GRP78 (1:400 ), ATF4 (1:50), p16 (1:100), p21 (1:200), ColⅢantibody (1:200), FN (1:300), 4℃overnight incubation; PBS wash; dropping horseradish peroxidase- labeled anti-mouse or anti-rabbit IgG, incubated at room temperature for 30min; PBS wash; DAB microscopic color; hematoxylin; dehydrated, mounted.4.3 Immunofluorescence detect renal tubular epithelial cells RAGE, GRP78, ATF4, p16, p21,TGF-β,ColⅢ,FNexpression and distribution Cold acetone fixed frozen sections of 20min, PBS wash; goat serum blocking 15min; antibody 4℃overnight; PBS wash; Respectively dropping FITC-labeled anti-IgG (1:50) and Cy3 labeled IgG (1:50), 37℃for 1h; PBS wash; DAPI nuclear staining; glycerol were mounted, observed under a confocal laser.4.4 Conventional biochemical methods detect renal tubular epithelial cells SA-β-gal expression In accordance with SA-β-gal staining kit steps , PH = 6.0 acidic liquid cleaning then dropping SA-β-gal staining working solution, 37℃incubation 12h, dried at room temperature, mounted.4.5 DAPI detect senescence-associated heterochromatin condensation change (SAHF) of renal tubular epithelial cell Cells seeded; 4% paraformaldehyde 30min; PBS wash; DAPI nuclear staining; glycerol mounted, observed under a confocal laser.4.6 Brdu marker detect renal tubular epithelial cell proliferation. Brdu Mark 37℃incubated 90min; PBS wash; cold acetone 20min; PBS wash; goat serum for 15min; dropping anti Brdu, 4℃overnight; PBS wash; dropping FITC-IgG, 37℃incubated for 1hour; PBS rinse; DAPI nuclear staining; glycerol mounted, observed under a confocal laser.4.7 Flow cytometry detect ratio of renal tubular epithelial cell cycle Using cell-flow analysis kit and cell flow cytometry detect cell cycle.4.8 RT-PCR detect renal tubular epithelial cell ATF4, p16, and p21 mRNA expression Total RNA was extracted from cells with TRIzol reagent the system in 20μL reverse transcription reaction , cDNA as a template for nucleic acid quantification.β-actin as internal control, primers are as follows: ATF4 upstream: 5'GCCCCCTTTACATT CTTGCAGC 3 ',downstream 5'GAGGGGCTATGCT GGGG AGA 3', p16 upstream 5'GCCAATCCCAAGAGCAGAGC 3 ', downstream 5'CC GCCTTCGCT CAGTT TCTC 3', p21 upstream 5'GCCTTGTCGCTGTCTTGCACT 3 ', downstream 5'GAGAGGG CAGGCAGCGTATATA 3';β-actin upstream 5'CAACTCCATCATGAAGTGTAAC3',Downstream5'CCACACGGAGTACTTGCGCTC 3 ', using 20μL reaction system in the ABI 7500 real-time quantitative PCR amplification of gene amplification. monitor fluorescent signal of each cycle real-time during PCR reaction, The relative amount of mRNA was calculated using the comparative Ct (2?ΔΔCt) method.4.9 Western blot detect renal tubular epithelial cell GRP78,ATF4,p16,p21,TGF-β,ColⅢprotein expressionExtraction of total cellular protein; Coomassie brilliant blue to detect protein concentration; protein heat denaturation; SDS-polyacrylamide gel electrophoresis; transfer film; 5% nonfat dry milk closed 2 h, anti-GRP78 (1:200), ATF4 (1:200), p16 (1:200), p21 (1:200), TGF-β(1:1000),ColⅢ(1:1000), 4℃overnight; TBST buffer wash; adding horseradish peroxidase-conjugated secondary antibody IgG (1:1 0000), incubated for 1 h at room temperature ; TBST buffer wash; darkroom light, X- ray film exposure, developing and fixing.4.10 Immunoprecipitation detect interaction renal tubular epithelial cells ATF4 protein and p16, p21 proteinDivided into:Normal control group;AGEs group;AGEs+ ATF4 siRNA group;ATF4-GFP group;after extraction of cellular proteins, the protein in three copies, including one to do Input, the remaining two copies, respectively, with anti-ATF4 monoclonal antibodies and rabbit immune serum (control IgG) precipitate the corresponding antigen, and then use protein A-agarose to antigen-antibody complex adsorbed on agarose beads, centrifugal and cleaning other proteins, and then use sample buffer and heat denaturation method to agarose beads and protein complexes separated by SDS-PAGE separation of the antigen and antibody, Western blotting analysis ATF4, p16 and p21 protein expression 1. The role and significance in AGEs-induced premature aging of renal tubular epithelial cells1.1 The role in AGEs-induced cell premature aging of renal tubular epithelial In vivo study found that diabetic patients eGFR was significantly lower, 24h urine protein levels, serum AGEs levels and urinary AGEs / Cr was significantly higher than those of the control level (P <0.05), serum AGEs level and eGFR changes has a significant negative correlation (r =- 0.722, P <0.05). Diabetic kidney cytoplasmic SA-β-Gal-positive tubular epithelial cells were significantly increased, the proportion of tubular epithelial cells increased in nucleus p16, p21-positive, and significantly positively correlated with urinary AGEs / Cr] (r = 0.735 , P <0.05; r = 0.579, P <0.05). The results suggest that renal tubular epithelial cells premature aging in diabetic nephropathy have related to the increased AGEs excretion of kidney. In vitro, with AGE-BSA concentration and time increments, renal tubular epithelial cells SA-β-gal, SAHF-positive rate and the proportion of G0/G1 phase cells were significantly increased (P <0.05), Brdu nuclear-positive cells was significantly lower (P <0.05). Western bolt analysis showed that AGEs increase p16 and p21 protein expression in renal tubular epithelial cells.The results show that AGEs can lead to premature aging of renal tubular epithelial cells.1.2 The relationship between renal tubular epithelial cells premature aging and renal interstitial lesions of diabetic nephropathy Immunofluorescence detected, renal interstitial p16, p21-positive tubular epithelial cells increased have same parts with ColⅢ, FN increased expression in DN patients with; AGEs incubation, SAHF-positive tubular epithelial cells increase in size and the cytoplasm TGF-βexpression increased, in the same changes of the 6th generation cultured in vitro natural aging in renal tubular epithelial cells. Western bolt analysis showed that, in order to elect flow cytometry after incubation of AGEs in renal tubular epithelial cells in G0/G1 phase ,TGF-βand ColⅢexpression increased. The results suggest that AGEs-induced premature aging of renal tubular epithelial cells produc increased cells matrix, participate in development of renal interstitial fibrosis in diabetic nephropathy.Results renal tubular epithelial cells Immunohistochemistry shows, renal tubular epithelial cells with the endoplasmic reticulum chaperone GRP78 expression in DN patients was significantly higher than the control group (P <0.05). Immunofluorescence detected GRP78-positive tubular epithelial cells, the nucleus of p16, p21 was also positive, while the control group, although there is the basis of the amount of GRP78 expression, the nucleus of p16, p21 was negative. The results suggest that renal tubular epithelial cells over-endoplasmic reticulum stress on diabetic nephropathy may be related to premature aging of the cells.In vitro studies, Western blot results show, AGEs increased GRP78 expression in renal tubular epithelial cells, and have time and dose dependent relationship with AGEs. Immunofluorescence shows, AGEs and renal tubular epithelial cells after incubation, the cytoplasm GRP78 and nuclei SAHF-positive and cytoplasm GRP78and nuclei p16-positive cells was significantly increased compared with the control group. The results suggest that AGEs-induced excessive endoplasmic reticulum stress may be closely related with cellular premature aging. incubated with the endoplasmic reticulum stress inhibitors 4-PBA pretreatment renal tubular epithelial cells plus AGEs, found that GRP78 protein expression in renal tubular epithelial cells was significantly lower (lower 52.3%); SA-β-gal, SAHF-positive cells and the proportion of G0/G1 phase cells was significantly lower (P <0.05), Brdu nuclear-positive cells was significantly increased (P <0.05). The results show that inhibition of endoplasmic reticulum stress can be reduced AGEs-induced premature aging of renal tubular epithelial cells.To further confirm the relationship between endoplasmic reticulum stress and cell premature aging, incubate the second generation of tubular epithelial cells with endoplasmic reticulum stress inducer TM and TG respectively. The results showed, TM and TG significantly increased renal tubular epithelial cells in p16, p21 protein expression (P <0.05), and SA-β-gal, SAHF-positive cells and the proportion of G0/G1 phase cells were significantly increased (P <0.05), Brdu nuclear-positive cells were significantly lower (P <0.05). Confocal analysis showed, TM and TG after incubation with renal tubular epithelial cells, the cytoplasm GRP78 and nuclei SAHF-positive and cytoplasm GRP78 and nuclei of p16-positive cells was significantly increased compared with the control group. Suggesting that endoplasmic reticulum stress inducers can induce premature aging of renal 2. The role of endoplasmic reticulum stress in AGE-induced premature aging of tubular epithelial cells by activating endoplasmic reticulum stress.3. The relationship among AGEs activated endoplasmic reticulum-derived transcription factor ATF4 and premature aging of renal tubular epithelial cells and interstitial fibrosisImmunohistochemistry showed in the control kidney tissue ATF4 only a small amount expression in renal tubular epithelial cells cytoplasm, ATF4 occurs nuclear translocation in DN patients and ATF4-positive cells were significantly increased. Confocal analysis showed, renal tubular epithelial cell nuclei ATF4 and p16-positive in DN patients,ATF4 and p21-positive cells increased, while the control group was not detected in renal tubular epithelial cell nuclei ATF4, p16 and p21 expression. In vitro studies have shown that, AGEs significantly increased ATF4 expression in renal tubular epithelial cells, both with concentration and time dependent (P <0.05). Confocal analysis showed that, AGEs group size increased ATF4-positive tubular epithelial cells increased, while the control group of normal renal tubular epithelial cells, only a small amount of cytoplasmic ATF4-positive signal; In addition, AGEs group of renal tubular epithelial cell nuclei ATF4 and p16 double positive, ATF4 and p21 double positive cells was significantly increased compared with the control group, suggesting that AGEs caused premature aging of cells may be activated by ATF4.We further use ATF4 gene silencing and ATF4 over-expression technology, verify ATF4-mediated renal tubular epithelial cells premature aging effect. The results showed that, ATF4 siRNA can significantly inhibit renal tubular epithelial cells ATF4 mRNA and protein expression, inhibition rates were 79.32%, 74.08% (P <0.05). ATF4 gene silencing can significantly reduce AGEs group SA-β-gal, SAHF-positive cells and the proportion of G0/G1 phase cells (P <0.05), Brdu positive cells was significantly higher (P <0.05), p16 and p21 expression was decreased, Col III expression was decreased. with ATF4-GFP plasmid adenovirus to transfect tubular epithelial cells (transfection efficiency was 96.78%), its ATF4 protein expression increased 9.45-fold compared with the control group. further observed the effect of ATF4 high expression to renal tubular epithelial cells premature aging phenotype. The results showed that, ATF4 plasmid transfected SA-β-gal, SAHF-positive cells and the proportion of cells in G0/G1 phase compared with the control group was significantly increased (P <0.05), Brdu positive cells was significantly lower (P <0.05); western bolt tests showed, p16 and p21 expression increased, Col III expression was also significantly increased. Laser confocal microscope observed cross, ATF4 transfected ATF4 and p16 double positive, ATF4 and p21-positive cells were significantly increased, while the control group, no ATF4, p16 and p21 positive signal; In addition, ATF4 transfection group, TGF-βexpression increased, while the control group, no TGF-βexpression. The results show that AGEs can activate ATF4-mediated renal tubular epithelial cells premature aging and extracellular matrix expression。Immunoprecipitation method to verify the interaction of ATF4 and p16,p21. Found that ATF4 precipitated antigen, AGEs group can be respectively detected ATF4-p16, and ATF4-p21 complex exists, in the control group were negative. renal tubular epithelial cells incubate with ATF4 siRNA transfection plus with AGEs, not detected ATF4-p16 and ATF4-p21 complex bands. ATF4 plasmid on the renal tubules, may detect ATF4-p16 and ATF4-p21 complex exists. These results indicate that AGEs can activate ATF4 directly regulate biological effect of p16 and p21.ConclusionExcessive endoplasmic reticulum stress activate the pathway of ATF4-p16/p21 is a new mechanism of AGEs cause renal tubular epithelial cells premature aging, the latter promote renal interstitial fibrosis in diabetic nephropathy by increasing the expression of extracellular matrix.