Effects And Mechanisms Of E1Inhibition And Hydrogen Rich Saline On Neointimal Hyperplasia After Balloon Injury

Background and objectives:Nowadays drug eluting stents (DES) have become the leading roles in the treatment ofatherosclerotic diseases. DES have been designed to solve the restenosis after balloondilation and bared stents. The underlying mechanisms of restenosis are vascular smoothmuscle cells (VSMCs) proliferation and migration from medial layer to the intima. Thecoated drugs in the DES were targeted at VSMCs proliferation and then inhibit theneointima hyperplasia. However, DES also induced the delay of endothelialization and stentthrombosis, which was in the light of the drug. Meanwhile, the mechanisms on detailremain unknown. Therefore, it is critical to further unmask the molecular mechanisms ofneointima formation, discover some new drug targets for the prevention and treatment ofatherosclerosis and restenosis.Ubiquitin activating-enzyme E1(UBA1, E1): a novel therapeutic target for theprevention of restenosisApproximately80%of proteins were degraded through ubiquitin proteasome system(UPS). UPS was involved in many physiological and pathological processes. Proteindegradation contains two stages, ubiquitination and degradation. Ubiquitin, a76aminoacids protein, is the tag for protein to degrade. Ubiquitination is induced by three differentkinds of enzymes, E1, E2and E3, and eventually bind with protein through covalent bonds.In most species, only1or2E1molecules exist,20to30E2molecules and hundreds of E3enzymes. After ubiquitination, proteins were destined to be degraded in the proteasome.UPS was reported to be involved in the development of atherosclerosis and neointimahyperplasia previously. It was first reported that intense ubiquitin immunoreactivity in aortaneointima thickening, and accumulated in the carotid atherosclerotic plaques. Recently,proteasome inhibitors were demonstrated to reduce neointima areas. In vitro study alsoconfirmed that proteasome inhibitors prevent vascular smooth muscle cells (VSMCs) proliferation, migration and phenotype modulation. Thus, proteasome plays an pivotal rolein neointima hyperplasia, while the role of ubiquitination remains unknown.E1, as the apex of the UPS pathway, initiates the degradation of proteins. Since, thereare only two molecules in human, of which UBE1/UBA1is in the charge of ubiquitination.Based on the important role of UPS in the neointima hyperplasia as illustrated inproteasome, we hypothesized that E1might play a critical role in the neointima hyperplasiaas well.From part I to part IV, we examined the role of E1in the animal model and in vitrocultured VSMCs. We aimed to determine the role of E1in the neointima induced byvascular injury and reveal the potential therapeutic value of E1.Hydrogen: a novel therapeutic antioxidant for the prevention of restenosisOxidative stress has been recognized to an important mechanism for the vascularinjury induced neointima hyperplasia. Vascular injury initiates the oxidative stress, whichconsequently triggers inflammatory response and exacerbates neointima formation. In thepast decades, a growing body of evidence has demonstrated that antioxidants were effectiveto inhibit the neointima hyperplasia in animal model. However, clinical evidences showedthere is no significant improvement for patients using antioxidant. This dilemma mightimply new type should be developed. In2007, hydrogen was reported to neutralize ROSand considered as a novel biological antioxidant. In addition, the antioxidative effects wereproved in many other oxidative stresses associated pathological processes.In part V, we determined the effects of hydrogen on neointima and the underlyingmechanisms. Our findings may provide the evidence for the potential therapeuticapplication of hydrogen to prevent neointima hyperplasia.Methods:1．UPS changes after balloon injury and effects of local E1chemical inhibitor1.1Angioplasty of rat right carotid artery was performed by using a balloonembolectomy catheter, while other rats were subjected to same procedure without ballooninjury. At day7and day14, the rat carotid arteries were harvested. Western blot wasemployed to detect the amount of ubiquitinated proteins and E1levels. Immunohistologychemical staining and fluorescence staining were used to locate the ubiquitinated proteins.1.2E1chemical inhibitor PYR-41at a concentration of100μM was delivered to injured carotid arteries while the control group was administrated with DMSO. PYR-41and DMSOwere infused and incubated for30min at the room temperature. The carotid arteries wereharvested at day7and14post-angioplasty. Hematoxylin-eosin staining (HE) was employedto detect the neointimal area, the media area and the ratio between them.2．Effects of E1knockdown shRNA lentivirus on neointimal hyperplasia2.1Construction of E1shRNA lentivirus: Four pairs of shRNA sequences were designedto knockdown E1and ligated into the miRNA plasmids. Knockdown plasmids weretransfected into VSMCs and the knockdown efficiency was measured by Realtime PCR. Twopairs of higher knockdown shRNAs were constructed into lentivirus transfer vector andpseudo-lentivirus was produced with packaging plasmid and envelope plasmids.2.2Local delivery of E1knockdown shRNA lentivirus to the injured carotid artery:Lentivirus containing E1shRNA were transfected into VSMCs, and the transfectionefficiency was measure by flow cytometry. The knockdown efficiency was measured byrealtime PCR and Western Blot. Then, lentivirus with GFP tag containing shRNA against E1and control lentivirus (30μL) were infused the ligated segment of right carotid artery for30min. The local delivery efficiency was detected by immunohistological staining of GFP at day3post-angioplasty. At day3,7and14, western blot for GFP protein levels was also detected.HE staining was also employed to detect the neointima area at day7and14after localdelivery of lentivirus.3．Effects of E1inhibition on apoptosis and inflammatory response in carotid artery.At3h and8h post-angioplasty, apoptosis in the local arterial wall was detected withTUNEL. Western Blot and immunohistological fluorescence staining were both employed todetect the expression of NFκB and CD68after PYR-41and lentivirus carrying shRNAagainst E1at7d and14d after balloon injury. The DNA binding ability of NFκB wasmeasured by EMSA.4．In vitro study on VSMCs function after E1inhibition and the underlying mechanisms4.1VSMCs cultured from rat aorta artery were cultured, and identified with SM α actinstaining. VSMCs proliferation was measured after PYR-41and E1lentivirus knockdownthrough cell counting and3H-TdR incorporation. Flow cytometry were employed to detectedthe cell cycle. The apoptosis rates were measured with AnnexinV/PI kit in flow cytometry.4.2Proteins were extracted form VSMCs after PYR-41and E1shRNA treatment. Short life proteins such as p53, p21, c-jun, IκBα and IκBβ were detected. EMSA were alsoemployed to measure the DNA binding ability of NFκB.5．Effects of Hydrogen rich saline solution (HRSS) and corresponding mechanisms5.1The pH value was measured after prepared. Hydrogen content in the prepared salineand medium and in animal blood was determined with gas chromatography.5.2HRSS were administrated into the rat intraperitoneally (10mL/kg). The neointimawas stained with HE and then the areas were measured at day7and14after HRSS treatment.5.3DHE was employed to measure the ROS levels in the injued carotid artery after theinjection of HRSS. MDA, GSH, SOD in the serum and the injured carotid arteries weremeasured following the kit instructions. IL-6mRNA and protein was measured via PCR andWestern Blot, respectively. NFκB p65and TNFα were also detected using Western Blot.5.4VSMCs proliferation changes after hydrogen rich medium were measured with cellcounting and CCK-8kit. Boyden chamber was used to measure the migration of VSMCs.Results:1．At day7and14post-angioplasty, ubiquitinated proteins were elevated significantly(p<0.05), while E1levels did not differ (p>0.05). The increased ubiquitinated proteins werelocated in the neointima. Local delivery of PYR-41led to significant decrease of the intimaarea at day7and14post-angioplasty (p<0.05). Meanwhile, the percentages of PCNApositive cell were also reduced markedly.2．Sequencing reports showed that the designed shRNA were successfully ligated intothe plasmids. The two shRNA sequences with higher knockdown efficiency wereCTCTTGTTGAAGACTTCCTTA,CCTGGGATGTCACGAAGTTAA. Lentivirus particlescontaining shRNA against E1were produced and the titers were1.02×109/mLå’Œ8.22×108/mL. Efficiency of lentivirus into VSMCs were90.3±0.9%. Lentivirus containingshRNA against E1significantly decreased the mRNA and proteins levels of E1(p<0.05).Immunohistological staining showed that GFP protein was detected at day3after lentiviruslocal delivery into the balloon injured artery, while Western Blot showed the presence ofGFP even at day14after local transfection. The neointima area decreased significantly atday7and day14post-angioplasty by42.4%and32.5%respectively (p<0.01). Thepercentage of PCNA positive cells was also reduced from40.12±3.81%in the control groupto22.17±1.53%in E1knockdown group. 3．Compared with control group, PYR-41induced the cell apoptosis in the vascular wallat both3h and8h postangioplasty.PYR-41treatment and E1knockdown both reduced theexpression and translocation of NFκB p65,and reduced the DNA binding abilitysimultaneously. CD68, a monocyte/macrophage marker, was also decreased after PYR-41treatment and E1knockdown through immunohistology fluorescence staining and WesternBlot.4．In vitro studies, we found that PYR-41inhibited the proliferation of VSMCs in adose dependent manner. E1knockdown also decreased VSMCs proliferation. Both PYR-41and E1knockdown reduced the percentage of S phage VSMCs. Besides, PYR-41inducedVSMCs apoptosis in a dose dependent manner even in the presence of serum. ChemicalPYR-41inhibition and E1shRNA knockdown both blocked the degradation of short lifeproteins and remarkably increased the levels of p21, p53and c-jun (p<0.01). In addition,NFκB p65protein levels were also inhibited significantly (p<0.01). EMSA was employedand NFκB p65DNA binding activity was also reduced. Moreover, E1inhibition on NFκBp65activity was induced by blocking IκBα, IκBβ degradation.5．The pH value did not differ between HRSS and PBS. HRSS increased serum H₂concentration after intraperitoneal injection. Five minutes after intraperitonealadministration, the peak arterial serum concentration of hydrogen was25.3±3.8μM, and itgradually decreased to normal within approximately30min. HRSS inhibited neointimalhyperplasia induced by balloon injury. Compared to PBS, a remarkable decrease ofPCNA-positive VSMCs in the carotid arteries treated with HRSS (PBS21.03±2.56%vs.HRSS9.17±4.86%, p<0.05). HRSS also neutralized ROS in the injured carotid artery,reduced MDA levels in the serum and injured carotid artery, and attenuated the decrease ofSOD and GSH in the serum and injured carotid artery (p<0.05). Besides, HRSS inhibitedthe inflammatory factors such as IL-6, TNFα and NFκB p65. CD68positive cells infiltratedto the injured carotid artery were also blocked by HRSS (p<0.05). In vitro studies showedthat hydrogen reduced8-OdH induced by high glucose and ROS induced by PDGF-BB.Meanwhile, hydrogen also attenuated VSMCs proliferation and migration induced byPDGF-BB (p<0.05).Conclusions:1．Ubiquitinated proteins were upregulated in the carotid artery after balloon injury. 2．Local delivery of chemical E1inhibitors PYR-41and genetic E1knockdown bothreduced the neointima hyperplasia.3．Local delivery of PYR-41and E1knockdown both reduced the inflammatoryresponse in the injured carotid artery.4．Chemical inhibitor PYR-41induced VSMCs apoptosis. E1inhibition, chemically orgenetically, blocked VSMCs proliferation and cell cycle progression.5．E1inhibition, chemically or genetically, blocked the degradation of short lifeproteins and reduced NFκB DNA binding ability.6．Hydrogen effectively prevented neointima hyperplasia after carotid balloon injury,suppressed ROS and TNF-α/NF-κB pathway. Hydrogen weakened PDGF-BB inducedVSMCs proliferation and migration.